Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Adults inhabit lagoons, reef passages, and the outer reef slopes as solitary individuals or in small groups. Feed on copepods, amphipods, mysids, fish eggs, crustacean larvae, and a small portion of algae (Ref. 7247). Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
  • Allen, G.R. 1991 Damselfishes of the world. Mergus Publishers, Melle, Germany. 271 p. (Ref. 7247)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-West Pacific: Red Sea and eastern Africa to Melanesia, Micronesia and the Samoa Islands; Ryukyu Islands south to Rowley Shoals and Great Barrier Reef. Further study is required to determine if the Indian Ocean-Red Sea population represents a distinct species.
  • Allen, G.R. 1991 Damselfishes of the world. Mergus Publishers, Melle, Germany. 271 p. (Ref. 7247)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa to Micronesia and Samoa, north to Ryukyu Islands, south to Rowley Shoals (Western Australia) and Queensland (Australia).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13; Dorsal soft rays (total): 12 - 13; Analspines: 2; Analsoft rays: 12 - 14
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

13.0 cm TL (male/unsexed; (Ref. 9710))
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description: Exhibits geographic variations in coloration. Indonesian populations with yellow-orange belly (Ref. 48636). Head and body grey, scale margins darker grey, pelvic fins yellow, spot black on pectoral fin base upper part. Body depth 1.5-1.8 in SL (Ref. 90102).
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 2 - 45 m (Ref. 7247)
  • Allen, G.R. 1991 Damselfishes of the world. Mergus Publishers, Melle, Germany. 271 p. (Ref. 7247)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 59 specimens in 1 taxon.
Water temperature and chemistry ranges based on 32 samples.

Environmental ranges
  Depth range (m): 1.5 - 187
  Temperature range (°C): 25.275 - 29.039
  Nitrate (umol/L): 0.047 - 1.251
  Salinity (PPS): 32.185 - 40.307
  Oxygen (ml/l): 4.130 - 4.727
  Phosphate (umol/l): 0.088 - 0.380
  Silicate (umol/l): 1.005 - 6.058

Graphical representation

Depth range (m): 1.5 - 187

Temperature range (°C): 25.275 - 29.039

Nitrate (umol/L): 0.047 - 1.251

Salinity (PPS): 32.185 - 40.307

Oxygen (ml/l): 4.130 - 4.727

Phosphate (umol/l): 0.088 - 0.380

Silicate (umol/l): 1.005 - 6.058
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154). Inhabits lagoons, reef passages, and the outer reef slopes as solitary individuals or in small groups. Feeds on benthic and planktonic organisms (Ref. 7247).
  • Allen, G.R. 1991 Damselfishes of the world. Mergus Publishers, Melle, Germany. 271 p. (Ref. 7247)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
  • Breder, C.M. and D.E. Rosen 1966 Modes of reproduction in fishes. T.F.H. Publications, Neptune City, New Jersey. 941 p. (Ref. 205)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Amblyglyphidodon leucogaster

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTCTATCTAGTATTCGGTGCTTGAGCTGGAATAGTAGGCACGGCTTTAAGCCTCCTCATTCGAGCAGAACTAAGCCAACCAGGCGCCCTCTTAGGAGACGACCAAATTTATAACGTTATTGTTACCGCACATGCCTTTGTAATAATTTTCTTTATAGTAATACCAATCCTAATCGGAGGATTTGGAAACTGGCTAGTTCCACTCATGCTCGGCGCCCCCGACATGGCATTCCCCCGAATAAATAACATAAGCTTCTGACTACTGCCCCCATCCTTCCTTCTTCTCCTTGCCTCCTCTGGAGTTGAGGCCGGAGCCGGGACGGGCTGAACTGTATACCCTCCACTATCCGGAAACCTAGCCCACGCAGGGGCGTCAGTAGACCTAACCATTTTCTCCCTCCATCTAGCAGGTGTCTCATCAATCCTGGGGGCAATTAACTTTATTACCACCATTATTAATATGAAACCTCCTGCCATTTCACAATATCAGACCCCTCTGTTTGTATGAGCCGTACTAATTACTGCCGTCCTGCTTCTCTTGTCACTTCCTGTCCTAGCAGCTGGTATTACCATGCTCTTAACCGACCGAAACCTAAATACTACCTTCTTTGACCCAGCAGGAGGAGGAGATCCAATTCTTTACCAACACCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Amblyglyphidodon leucogaster

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 43 specimens with morphological vouchers housed at British Antarctic Survey
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: unknown; price reliability:
  • Robins, C.R., R.M. Bailey, C.E. Bond, J.R. Brooker, E.A. Lachner, R.N. Lea and W.B. Scott 1991 World fishes important to North Americans. Exclusive of species from the continental waters of the United States and Canada. Am. Fish. Soc. Spec. Publ. (21):243 p. (Ref. 4537)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Amblyglyphidodon leucogaster

Amblyglyphidodon leucogaster, known commonly as the Yellowbelly damselfish , is a species of marine fish in the family Pomacentridae, the damselfishes and clownfishes.

It's widespread throughout the tropical waters of the Indo-West Pacific, Red Sea included.[1]

It's a small size fish that can reach a maximum size of 13 cm length.[2]

References[edit]

  1. ^ http://eol.org/pages/994446/details#distribution
  2. ^ http://www.fishbase.org/summary/5691
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!