Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Adults inhabit lagoon and outer reefs in shallow areas exposed to mild or moderate surge. Feed on benthic algae and small invertebrates (Ref. 7247). Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205). Highly territorial (Ref. 9710).
  • Allen, G.R. 1991 Damselfishes of the world. Mergus Publishers, Melle, Germany. 271 p. (Ref. 7247)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-Pacific: East Africa to the Line and Tuamoto islands, north to southern Japan, south to southern Great Barrier Reef.
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: East Africa, Seychelles, Madagascar and Mascarenes east to Line Islands and Gambier Islands, north to Izu Islands, south to Western Australia, New South Wales (Australia), New Caledonia and Tonga.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13; Dorsal soft rays (total): 12 - 14; Analspines: 2; Analsoft rays: 11 - 13
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 230 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

23.0 cm TL (male/unsexed; (Ref. 4391))
  • Allen, G.R. 1986 Pomacentridae. p. 670-682. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 4391)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Inhabits lagoon and outer reefs in shallow areas exposed to mild or moderate surge. Feeds on benthic algae and small invertebrates.
  • Froese, R. & D. Pauly (Editors). (2014). FishBase. World Wide Web electronic publication.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description: Head and body white, vertical bars five grey diffuse, first three bars shading from darker to lighter from dorsal to ventral. Body depth 1.7-2.0 in SL (Ref. 90102).
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 0 - 3 m (Ref. 4391)
  • Allen, G.R. 1986 Pomacentridae. p. 670-682. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 4391)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 16 specimens in 1 taxon.
Water temperature and chemistry ranges based on 9 samples.

Environmental ranges
  Depth range (m): 0.4575 - 100
  Temperature range (°C): 25.335 - 28.709
  Nitrate (umol/L): 0.130 - 0.402
  Salinity (PPS): 34.563 - 36.148
  Oxygen (ml/l): 4.503 - 4.807
  Phosphate (umol/l): 0.120 - 0.295
  Silicate (umol/l): 1.185 - 4.752

Graphical representation

Depth range (m): 0.4575 - 100

Temperature range (°C): 25.335 - 28.709

Nitrate (umol/L): 0.130 - 0.402

Salinity (PPS): 34.563 - 36.148

Oxygen (ml/l): 4.503 - 4.807

Phosphate (umol/l): 0.120 - 0.295

Silicate (umol/l): 1.185 - 4.752
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 3m.
Recorded at 3 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154). Inhabits lagoon and outer reefs in shallow areas exposed to mild or moderate surge (Ref. 9710). An omnivorous species although algae form the bulk of the food (Ref. 275). Feeds on benthic algae and small invertebrates (Ref. 9710).
  • Hiatt, R.W. and D.W. Strasburg 1960 Ecological relationships of the fish fauna on coral reefs of the Marshall Islands. Ecol. Monogr. 30(1):65-127. (Ref. 275)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
  • Breder, C.M. and D.E. Rosen 1966 Modes of reproduction in fishes. T.F.H. Publications, Neptune City, New Jersey. 941 p. (Ref. 205)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Abudefduf septemfasciatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTCTATCTAGTATTTGGTGCTTGAGCTGGGATAGTAGGCACAGCTTTAAGCCTCCTCATTCGAGCAGAACTTAGCCAACCAGGCGCTCTCCTCGGAGACGACCAGATTTATAACGTAATTGTTACGGCACACGCCTTTGTAATAATTTTCTTTATAGTAATGCCAATTATGATTGGAGGGTTCGGAAACTGACTAATTCCCCTTATGATCGGTGCCCCCGACATGGCTTTCCCCCGAATAAATAACATGAGCTTCTGACTCCTCCCTCCCTCATTCCTACTTTTACTTGCCTCTTCCGGAGTTGAGGCAGGTGCAGGAACAGGTTGGACTGTCTACCCTCCCCTGTCTGGTAACTTAGCCCATGCAGGAGCCTCTGTTGACCTAACTATCTTCTCCCTCCATCTAGCAGGTGTTTCCTCAATTTTAGGTGCCATCAACTTTATTACTACAATTATTAACATGAAACCCCCCGCTATCTCCCAATACCAGACCCCTCTCTTCGTATGGGCCGTGCTAATTACTGCCGTTCTTCTCCTTCTATCCCTCCCTGTCCTGGCCGCTGGGATCACAATGCTTTTAACCGACCGAAACCTAAACACCACATTCTTCGACCCTGCCGGAGGAGGGGATCCAATCCTTTACCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Abudefduf septemfasciatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 19
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 2 specimens with morphological vouchers housed at Ocean Genome Legacy
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: unknown; price reliability:
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!