Abudefduf notatus — Details

Yellow-tailed Sergeant-major learn more about names for this taxon

Overview

Comprehensive Description

Biology

Learn more about this article

Found in small groups along upper edges of sheltered drop-offs. Also found in rocky inshore reefs with moderate to strong wave action. In roving aggregations and somewhat difficult to approach (Ref. 9710). Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).

Allen, G.R. 1991 Damselfishes of the world. Mergus Publishers, Melle, Germany. 271 p. (Ref. 7247) http://www.fishbase.org/references/FBRefSummary.php?id=7247&speccode=11793

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Distribution

Learn more about this article

Indo-West Pacific: East Africa to Transkei, South Africa (Ref. 11228) and to New Caledonia, north to southern Japan.

Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602) http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Mozambique, Seychelles, South Africa (country)

Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp. http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5909
Smith, J.L.B. (1960). Coral Fishes of the Family Pomacentridae from the Western Indian Ocean and the Red Sea. Ichthyological Bulletin No. 19: 317-349 http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6186
Anon. (2000). FishBase 2000 [CD-ROM]. ICLARM: Los Baños, Laguna, Philippines. 4 cd-roms pp. http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6542
Smith, J.L.B. & M.M. Smith (1963). The fishes of Seychelles. Department of Ichthyology, Rhodes University. Grahamstown. http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5926

Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Indo-West Pacific.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Physical Description

Morphology

Learn more about this article

Dorsal spines (total): 13; Dorsal soft rays (total): 13 - 14; Analspines: 2; Analsoft rays: 13 - 14

Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602) http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Size

Learn more about this article

Maximum size: 170 mm TL

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Max. size

Learn more about this article

17.0 cm TL (male/unsexed; (Ref. 4391))

Allen, G.R. 1986 Pomacentridae. p. 670-682. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 4391) http://www.fishbase.org/references/FBRefSummary.php?id=4391&speccode=5110

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Diagnostic Description

Learn more about this article

Identified by the yellow tail (Ref. 48636).

Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602) http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Description

Learn more about this article

Found in small groups along upper edges of sheltered shear dropoffs. Also found in rocky inshore reefs of usually moderate to strong wave action.

Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp. http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5909

Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Type Information

Learn more about this article

Holotype for Abudefduf notatus
Catalog Number: USNM 68234
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): C. Gilbert, J. Snyder, M. Sindo, H. Heath, C. Burke, H. Torrey & A. Clark
Year Collected: 1906
Locality: Aikawa, Rikuzen, Japan., Honshu, Japan, Pacific
Vessel: Albatross

Holotype: Snyder, J. O. 26 May 1911. Proceedings of the United States National Museum. 40 (1836): 534.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Paratype for Abudefduf notatus
Catalog Number: USNM 74534
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): C. Gilbert, J. Snyder, M. Sindo, H. Heath, C. Burke, H. Torrey & A. Clark
Year Collected: 1906
Locality: Aikawa, Rikuzen, Japan., Honshu, Japan, Pacific
Vessel: Albatross

Paratype: Snyder, J. O. 26 May 1911. Proceedings of the United States National Museum. 40 (1836): 534.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Paratype for Abudefduf notatus
Catalog Number: USNM 74588
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): C. Gilbert, J. Snyder, M. Sindo, H. Heath, C. Burke, H. Torrey & A. Clark
Year Collected: 1906
Locality: Same, Rikuoku, Japan., Honshu, Japan, Pacific
Vessel: Albatross

Paratype: Snyder, J. O. 26 May 1911. Proceedings of the United States National Museum. 40 (1836): 534.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Ecology

Habitat

Environment

Learn more about this article

reef-associated; non-migratory; marine; depth range 1 - 12 m (Ref. 7247)

Allen, G.R. 1991 Damselfishes of the world. Mergus Publishers, Melle, Germany. 271 p. (Ref. 7247) http://www.fishbase.org/references/FBRefSummary.php?id=7247&speccode=11793

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Depth range based on 5 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 0.5 - 12
  Temperature range (°C): 23.208 - 27.306
  Nitrate (umol/L): 0.365 - 0.800
  Salinity (PPS): 34.253 - 35.346
  Oxygen (ml/l): 4.577 - 4.940
  Phosphate (umol/l): 0.171 - 0.179
  Silicate (umol/l): 2.417 - 3.666

Graphical representation

Depth range (m): 0.5 - 12

Temperature range (°C): 23.208 - 27.306

Nitrate (umol/L): 0.365 - 0.800

Salinity (PPS): 34.253 - 35.346

Oxygen (ml/l): 4.577 - 4.940

Phosphate (umol/l): 0.171 - 0.179

Silicate (umol/l): 2.417 - 3.666

Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Public Domain

Source: Ocean Biogeographic Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Depth: 1 - 12m.
From 1 to 12 meters.

Habitat: reef-associated.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Trophic Strategy

Learn more about this article

Found in small groups along upper edges of sheltered drop-offs. Also found in rocky inshore reefs with moderate to strong wave action (Ref. 7247).

Masuda, H. and G.R. Allen 1993 Meeresfische der Welt - GroÃ-Indopazifische Region. Tetra Verlag, Herrenteich, Melle. 528 p. (Ref. 9137) http://www.fishbase.org/references/FBRefSummary.php?id=9137&speccode=127

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Life History and Behavior

Life Cycle

Learn more about this article

Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).

Breder, C.M. and D.E. Rosen 1966 Modes of reproduction in fishes. T.F.H. Publications, Neptune City, New Jersey. 941 p. (Ref. 205) http://www.fishbase.org/references/FBRefSummary.php?id=205&speccode=1256

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Molecular Biology and Genetics

Molecular Biology

Barcode data: Abudefduf notatus

Learn more about this article

The following is a representative barcode sequence, the centroid of all available sequences for this species.

There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.

CCTTTATCTGGTATTTGGTGCTTGAGCTGGAATAGTAGGCACAGCTTTAAGCCTCCTTATTCGAGCAGAACTTAGCCAACCAGGCGCTCTCCTCGGAGACGACCAAATTTATAACGTAATTGTTACGGCGCACGCCTTTGTAATAATTTTCTTTATAGTAATACCAATTATGATCGGAGGATTTGGGAACTGACTAATCCCCCTTATGATTGGTGCCCCCGATATGGCTTTCCCCCGAATAAACAACATGAGCTTCTGGCTCCTCCCACCCTCATTCCTACTTTTACTTGCCTCTTCCGGAGTTGAAGCAGGTGCAGGAACAGGTTGAACTGTCTACCCTCCCCTGTCTGGCAACTTAGCCCATGCAGGAGCCTCTGTCGACCTGACTATCTTTTCCCTTCACCTAGCAGGTGTCTCCTCAATTCTAGGCGCCATCAACTTTATTACTACAATTATTAATATGAAACCTCCGGCCATCTCCCAGTATCAAACCCCTCTCTTCGTATGAGCCGTACTAATTACTGCCGTTCTTCTCCTTCTATCCCTCCCTGTCCTAGCCGCTGGAATTACAATGCTATTAACTGACCGAAATCTAAATACCACATTCTTTGACCCTGCCGGAGGAGGGGACCCAATTCTTTACCAACATCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Statistics of barcoding coverage: Abudefduf notatus

Learn more about this article

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 5
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Conservation

Threats

Learn more about this article

Not Evaluated

IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006. http://www.fishbase.org/references/FBRefSummary.php?id=57073

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Relevance to Humans and Ecosystems

Benefits

Importance

Learn more about this article

fisheries: of no interest

Allen, G.R. 1986 Pomacentridae. p. 670-682. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 4391) http://www.fishbase.org/references/FBRefSummary.php?id=4391&speccode=5110

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!