Overview

Comprehensive Description

Biology

Found in small groups along upper edges of sheltered drop-offs. Also found in rocky inshore reefs with moderate to strong wave action. In roving aggregations and somewhat difficult to approach (Ref. 9710). Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-West Pacific: East Africa to Transkei, South Africa (Ref. 11228) and to New Caledonia, north to southern Japan.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mozambique, Seychelles, South Africa (country)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13; Dorsal soft rays (total): 13 - 14; Analspines: 2; Analsoft rays: 13 - 14
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 170 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

17.0 cm TL (male/unsexed; (Ref. 4391))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Identified by the yellow tail (Ref. 48636).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Found in small groups along upper edges of sheltered shear dropoffs. Also found in rocky inshore reefs of usually moderate to strong wave action.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Holotype for Abudefduf notatus
Catalog Number: USNM 68234
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): C. Gilbert, J. Snyder, M. Sindo, H. Heath, C. Burke, H. Torrey & A. Clark
Year Collected: 1906
Locality: Aikawa, Rikuzen, Japan., Honshu, Japan, Pacific
Vessel: Albatross
  • Holotype: Snyder, J. O. 26 May 1911. Proceedings of the United States National Museum. 40 (1836): 534.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Abudefduf notatus
Catalog Number: USNM 74534
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): C. Gilbert, J. Snyder, M. Sindo, H. Heath, C. Burke, H. Torrey & A. Clark
Year Collected: 1906
Locality: Aikawa, Rikuzen, Japan., Honshu, Japan, Pacific
Vessel: Albatross
  • Paratype: Snyder, J. O. 26 May 1911. Proceedings of the United States National Museum. 40 (1836): 534.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Abudefduf notatus
Catalog Number: USNM 74588
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): C. Gilbert, J. Snyder, M. Sindo, H. Heath, C. Burke, H. Torrey & A. Clark
Year Collected: 1906
Locality: Same, Rikuoku, Japan., Honshu, Japan, Pacific
Vessel: Albatross
  • Paratype: Snyder, J. O. 26 May 1911. Proceedings of the United States National Museum. 40 (1836): 534.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 1 - 12 m (Ref. 7247)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 5 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 0.5 - 12
  Temperature range (°C): 23.208 - 27.306
  Nitrate (umol/L): 0.365 - 0.800
  Salinity (PPS): 34.253 - 35.346
  Oxygen (ml/l): 4.577 - 4.940
  Phosphate (umol/l): 0.171 - 0.179
  Silicate (umol/l): 2.417 - 3.666

Graphical representation

Depth range (m): 0.5 - 12

Temperature range (°C): 23.208 - 27.306

Nitrate (umol/L): 0.365 - 0.800

Salinity (PPS): 34.253 - 35.346

Oxygen (ml/l): 4.577 - 4.940

Phosphate (umol/l): 0.171 - 0.179

Silicate (umol/l): 2.417 - 3.666
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 1 - 12m.
From 1 to 12 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Found in small groups along upper edges of sheltered drop-offs. Also found in rocky inshore reefs with moderate to strong wave action (Ref. 7247).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Abudefduf notatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTTTATCTGGTATTTGGTGCTTGAGCTGGAATAGTAGGCACAGCTTTAAGCCTCCTTATTCGAGCAGAACTTAGCCAACCAGGCGCTCTCCTCGGAGACGACCAAATTTATAACGTAATTGTTACGGCGCACGCCTTTGTAATAATTTTCTTTATAGTAATACCAATTATGATCGGAGGATTTGGGAACTGACTAATCCCCCTTATGATTGGTGCCCCCGATATGGCTTTCCCCCGAATAAACAACATGAGCTTCTGGCTCCTCCCACCCTCATTCCTACTTTTACTTGCCTCTTCCGGAGTTGAAGCAGGTGCAGGAACAGGTTGAACTGTCTACCCTCCCCTGTCTGGCAACTTAGCCCATGCAGGAGCCTCTGTCGACCTGACTATCTTTTCCCTTCACCTAGCAGGTGTCTCCTCAATTCTAGGCGCCATCAACTTTATTACTACAATTATTAATATGAAACCTCCGGCCATCTCCCAGTATCAAACCCCTCTCTTCGTATGAGCCGTACTAATTACTGCCGTTCTTCTCCTTCTATCCCTCCCTGTCCTAGCCGCTGGAATTACAATGCTATTAACTGACCGAAATCTAAATACCACATTCTTTGACCCTGCCGGAGGAGGGGACCCAATTCTTTACCAACATCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Abudefduf notatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!