Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Adults are found in large aggregations above thickets of branching Acropora corals in sheltered areas such as subtidal reef flats and lagoons. Juveniles closely tied to individual coral heads (Ref. 9710). Phytoplankton feeders. Breeding is done on sand and rubble. Males prepare nest for spawning which is shared with several females. Large number of eggs spawned hatching in 2-3 days. Males guard the nest ventilating fertilized egg with their caudal fins and feeding on those which do not hatch. Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Red Sea, Indo-West Pacific: East Africa, Madagascar and Mascarenes east to Wake Atoll, Marquesas Islands and Tuamotu Archipelago, north to Ryukyu Islands, south to Western Australia, Middleton Reef, New Caledonia and Tonga.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-Pacific: Red Sea to the Line, Marquesan, and Tuamoto islands, north to the Ryukyu Islands, south to New Caledonia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 12; Dorsal soft rays (total): 9 - 11; Analspines: 2; Analsoft rays: 9 - 11
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 70 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

8.0 cm TL (male/unsexed; (Ref. 48636))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Found in large aggregations above thickets of branching corals (@Acropora@)in sheltered areas such as subtidal reef flats and lagoons. Phytoplankton feeders. Males prepare nest for spawning which is shared with several females. Large number of eggs spawned hatching in 2-3 days. Males guard the nest ventilating fertilized egg with their caudal fins and feeding on those which do not hatch.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Color is pale green to light blue; nesting male is yellow (changing hues during nesting), becoming blackish posteriorly. Looks similar to C. atripectoralis, but generally smaller and lacks the black area on the inside of the pectoral fin base.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth: 10 - 12m.
From 10 to 12 meters.

Habitat: reef-associated. Blue-green chromis.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; non-migratory; marine; depth range 10 - 12 m (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 96 specimens in 1 taxon.
Water temperature and chemistry ranges based on 44 samples.

Environmental ranges
  Depth range (m): 0.15 - 413
  Temperature range (°C): 22.496 - 28.988
  Nitrate (umol/L): 0.047 - 0.999
  Salinity (PPS): 32.019 - 40.307
  Oxygen (ml/l): 4.163 - 5.079
  Phosphate (umol/l): 0.055 - 0.415
  Silicate (umol/l): 0.819 - 5.552

Graphical representation

Depth range (m): 0.15 - 413

Temperature range (°C): 22.496 - 28.988

Nitrate (umol/L): 0.047 - 0.999

Salinity (PPS): 32.019 - 40.307

Oxygen (ml/l): 4.163 - 5.079

Phosphate (umol/l): 0.055 - 0.415

Silicate (umol/l): 0.819 - 5.552
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occur inshore (Ref. 75154). Found in large aggregations above thickets of branching Acropora corals in sheltered areas such as subtidal reef flats and lagoons (Ref. 9710, 54301). Juveniles closely tied to individual coral heads (Ref. 9710). Phytoplankton feeders.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Chromis viridis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 17
Specimens with Barcodes: 37
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Chromis viridis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 30 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTCTACCTAGTATTTGGTGCCTGAGCTGGAATAGTAGGCACAGCTTTAAGCCTCCTCATTCGAGCAGAACTGAGCCAACCAGGCGCCCTCCTCGGAGACGACCAGATTTATAATGTCATTGTTACAGCACACGCCTTTGTAATAATTTTCTTTATAGTAATGCCAATTATAATTGGAGGGTTCGGAAACTGACTTATTCCTCTCATGATCGGGGCCCCTGATATGGCATTCCCTCGAATGAACAACATAAGCTTCTGACTCCTCCCTCCCTCGTTTTTACTTCTACTTGCCTCTTCCGGTGTTGAAGCAGGTGCAGGTACAGGATGAACTGTATACCCTCCCCTGTCGGGAAACCTGGCTCACGCAGGGGCCTCTGTAGACCTAACTATTTTCTCCCTCCACCTGGCAGGTATTTCCTCAATCCTGGGAGCAATTAATTTTATTACTACCATCATTAACATGAAACCCCCTGCTATTTCTCAATATCAAACCCCACTCTTTGTATGAGCCGTTCTCATCACTGCTGTCCTTCTTCTACTCTCTCTCCCAGTCTTAGCTGCTGGCATCACCATGCTCCTAACTGATCGAAACCTAAATACCACCTTCTTCGACCCAGCGGGAGGAGGGGACCCAATTCTGTACCAGCACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Chromis viridis

The Green Chromis, Chromis viridis, is a species of damselfish. Individuals tend to be iridescent apple-green and light blue, and reach a maximal length of 10 cm.[1]

It is sometimes called "Blue-green Chromis", but that may also refer to Chromis caerulea, C. caerulea or Blue Puller, a close relative that is sometimes considered conspecific.

Habitat[edit]

The species is found in the Indo-Pacific, Red Sea included.[2] They live in large aggregations above Acropora corals in sheltered areas such as lagoons and reef flats and feed on phytoplankton. Juveniles live closely tied to individual coral heads.

Reproduction[edit]

C. viridis spawn over sand and rubble. The male prepares the nest which is shared with several females. The large number of eggs will hatch in 2–3 days. The male guards the nest, ventilating it with its fins and feeding on those eggs that do not hatch.

In aquaria[edit]

C. viridis over Acropora coral head

In a marine aquarium, schools should be kept in small groups of odd numbers. The Green Chromis is excellent for the saltwater aquarium novice because it is a peaceful, hardy fish, and it is relatively inexpensive. A small school will be more comfortable in a 30 gallon tank but a single specimen can be kept in a 10 gallon tank. Some aquarists have successfully bred the Blue Green Reef Chromis in the home aquarium.

Tankmates[edit]

The Green Chromis should not be housed with larger predatory fish, as they may become food themselves. Groupers, lionfish, and eels all present an element of danger for this peaceful species.

References[edit]


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!