Overview

Comprehensive Description

Biology

Juveniles inhabit shallow protected areas, while adults prefer coastal reefs with heavy coral growth providing ample hiding places. Generally solitary or in pairs. Feeds on sponges, tunicates, and algae (Ref. 30573). The young are excellent aquarium fish and suitable for a community tank.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-West Pacific: Red Sea and East Africa to Samoa, north to southern Japan, south to Western Australia and New South Wales, including Lord Howe Island (Ref. 1602).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is widely distributed throughout the Indian Ocean and western Pacific Ocean. It ranges from coastal eastern Africa (including South Africa) in the west, through the Indian Ocean to Fiji, Tonga and Samoa in the Pacific Ocean. It has been recorded as far north as southern Japan, ranging as far south as the east coast of Australia and Lord Howe Island (Australia) (Steene 1978, Pyle 2001, G.R. Allen pers. comm. 2006). It is found at depths of 1-40 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cargados Carajos, Comores, Djibouti, Eritrea, Kenya, Madagascar, Mauritius, Mozambique, Red Sea, Reunion, Rodriguez, Seychelles, Somalia, South Africa (country), Tanzania
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, Madagascar and Mascarenes east to Samoa and Tonga, north to southern Japan, south to Western Australia, New South Wales (Australia) and New Caledonia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13; Dorsal soft rays (total): 20 - 23; Analspines: 3; Analsoft rays: 18 - 22
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 400 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

40.0 cm SL (male/unsexed; (Ref. 30573))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Juveniles of this species are bluish black with concentric white semi-circles. Adults brownish on anterior and posterior third of the body; middle portion greenish or yellowish; numerous blue spots on the sides; posterior part of dorsal and anal fins prolonged as a filament, the tips bright yellow. Transformation to the adult color pattern occurs over the size range of about 8 - 16 cm.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Juveniles inhabits shallow protected areas, while adults prefer coastal reefs with heavy coral growth providing ample hiding places. Common in depths less than 25 m. Generally a solitary species. Apparently rare in Belau. The young are excellent aquarium fish and suitable for a community tank.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 1 - 30 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Populations of this species are generally associated with protected coastal reefs with rich coral growth (Steene 1978, Pyle 2001, G.R. Allen pers. comm. 2006). The adults are sometimes seen in caves and on wrecks. Juveniles tend to prefer shallow reefs mixed with sandy substrates. Food items include sponges, tunicates and algae (Steene 1978, Pyle 2001, G.R. Allen pers. comm. 2006).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 63 specimens in 1 taxon.
Water temperature and chemistry ranges based on 41 samples.

Environmental ranges
  Depth range (m): 0.5 - 96
  Temperature range (°C): 25.344 - 29.058
  Nitrate (umol/L): 0.045 - 0.732
  Salinity (PPS): 33.821 - 35.095
  Oxygen (ml/l): 4.450 - 4.744
  Phosphate (umol/l): 0.111 - 0.284
  Silicate (umol/l): 0.869 - 6.035

Graphical representation

Depth range (m): 0.5 - 96

Temperature range (°C): 25.344 - 29.058

Nitrate (umol/L): 0.045 - 0.732

Salinity (PPS): 33.821 - 35.095

Oxygen (ml/l): 4.450 - 4.744

Phosphate (umol/l): 0.111 - 0.284

Silicate (umol/l): 0.869 - 6.035
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 1 - 30m.
From 1 to 30 meters.

Habitat: reef-associated. Semicircle angel.  (Cuvier, 1831)  Attains over 40 cm. Indo-West Pacific. Common at Sodwana. A beautiful fish to photograph.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occur inshore(Ref. 75154). Juveniles inhabit shallow protected areas, while adults prefer coastal reefs with heavy coral growth providing ample hiding places. Generally solitary. Feed on sponges, tunicates, and algae (Ref. 30573). The young are excellent aquarium fish and suitable for a community tank.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Hole-in-the-Head Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Bacterial Infections (general). Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pomacanthus semicirculatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTCTATTTACTATTCGGTGCCTGAGCCGGAATGGTGGGCACAGGTTTAAGCCTGCTAATTCGAGCCGAACTAAACCAACCAGGTAGCCTTCTCGGGGACGACCAGATCTATAATGTAATCGTTACAGCACACGCATTTGTAATAATCTTTTTTATAGTGATACCAGCTATAATTGGGGGTTTCGGGAACTGATTGGTTCCACTGATAATTGGGGCCCCAGACATGGCATTCCCCCGAATAAACAATATAAGCTTTTGGCTCTTACCCCCCTCTCTCCTTCTTCTCCTTGCTTCCGCTGGAGTAGAAGCCGGAGCCGGAACTGGATGAACAGTTTACCCGCCTCTAGCCGGTAATCTAGCCCATGCAGGAGCATCCGTAGACTTAACCATTTTCTCCCTCCATCTGGCCGGAATTTCCTCAATTCTTGGAGCTATTAACTTTATTACAACTATTATTAACATAAAACCTCCCGCCATTTCGCAATACCAAACTCCACTGTTTGTGTGGGCCGTCCTAATTACTGCAGTATTACTTCTTCTCTCCCTTCCCGTCCTTGCCGCTGGCATTACTATGCTTCTCACAGACCGAAATCTAAACACCACCTTCTTCGACCCTGCAGGGGGCGGAGATCCAATCCTTTACCAGCACTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pomacanthus semicirculatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Pyle, R., Myers, R., Rocha, L.A. & Craig, M.T.

Reviewer/s
Elfes, C., Polidoro, B., Livingstone, S. & Carpenter, K.E.

Contributor/s

Justification
It is listed as Least Concern, as this is a common species with a wide range and no apparent major threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
It is generally common with stable populations.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats

There appear to be no major threats to this species. Collection for the aquarium trade is localized and does not seem to affect the global population.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place. Present within several marine protected areas throughout its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pomacanthus semicirculatus

The Koran angelfish or semicircle angelfish, Pomacanthus semicirculatus, is a ray-finned fish in the family Pomacanthidae. It is found in the Indo-West Pacific ocean. It occasionally makes its way into the aquarium trade.

Contents

Description

The adult semicircle angelfish is a pale brownish-green colour. It is a deep-bodied, laterally compressed fish that can grow to a length of 35 centimetres (14 in). The mouth is positioned just above the tip of the snout, and the eyes are set halfway up a long straight forehead. The scales have blue bases which gives the body a speckled effect. The fins, except for the pectorals, are rimmed in blue and so are the cheek, operculum and spine. The dorsal fin has 13 spines and 20–23 soft rays and the anal fin has 3 spines and 18–22 soft rays. Both these fins have filaments that trail behind as the fish swims. The pectoral fins are pale yellow and have 19–21 soft rays.

Juvenile Koran angelfish in a home aquarium

The juveniles in contrast, are blue-black marked from top to bottom with narrow white stripes. At the head end the stripes are fairly straight but they become increasingly curved as they approach the base of the tail. The juveniles gradually adopt the adult colouration when they are 8 to 16 centimetres (3.1 to 6.3 in).[2]

Distribution

The semicircle angelfish is found in the Indo-Pacific region. Its range extends from the east coast of Africa to Fiji and Japan, the east coast of Australia and New Caledonia. It has also been seen sporadically off the east coast of Florida since 1999 and at Oahu, Hawaii since 2005.[2]

Biology

The semicircle angelfish is found on sheltered coral reefs, where it feeds on algae, tunicates and sponges. The juveniles are very timid and difficult to approach.[2]

References

  1. ^ a b Bailly, Nicolas (2010). "Pomacanthus semicirculatus (Cuvier, 1831)". World Register of Marine Species. http://www.marinespecies.org/aphia.php?p=taxdetails&id=220003. Retrieved 2012-02-27.
  2. ^ a b c Pomacanthus semicirculatus (Cuvier, 1831): Semicircle Angelfish USGS. Retrieved 2012-02-27.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!