Overview

Comprehensive Description

Biology

Occurs in coral rich areas of clear lagoons, channels, and protected outer reef slopes. Changes to adult pattern is dramatic, and intermediate stage are rarely seen (Ref. 48636). Often solitary. Feeds on sponges and tunicates. Uncommon (Ref. 9710). Highly prized aquarium export (Ref. 37816).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-Pacific: Indonesia to Papua New Guinea, north to the Philippines, south to Rowley Shoals and the southern Great Barrier Reef; including Palau and Yap in Micronesia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is found throughout the Indo-Australian Archipelago and western edge of Micronesia, including Rowley Shoals (off Western Australia), New Guinea (Indonesia and Papua New Guinea), the Solomon Islands, northwards to the Philippines Islands, Palau and Yap Island (Federated States of Micronesia) (Pyle 2001, G.R. Allen pers. comm. 2006). It is found at depths of 3-40 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

West Pacific and southeastern Indian Ocean.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13 - 14; Dorsal soft rays (total): 17 - 18; Analspines: 3; Analsoft rays: 18
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 280 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

28.0 cm TL (male/unsexed; (Ref. 9710)); max. reported age: 15 years (Ref. 72479)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Juveniles black with light blue curve vertical stripes on the sides. Adults are bright yellow on sides and back, dorsal and caudal fins, with numerous blue spots; head and ventral portion of the body, pectoral and pelvic fins dark blue with numerous light blue spots on the posterior portion of the anal fin and the adjacent caudal peduncle area. Narrow light blue streaks run across the face from below the eye, and on the area just behind the head. Fins edged light blue.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 3 - 40 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species is associated with areas of rich coral growth in lagoons, channels and on outer reef slopes. The juveniles are mostly in shallow protected reef areas. Usually solitary or in pairs. The diet is comprised mostly of sponges and tunicates (Pyle 2001).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 5 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 5 - 35
  Temperature range (°C): 27.844 - 29.205
  Nitrate (umol/L): 0.068 - 0.678
  Salinity (PPS): 34.393 - 34.586
  Oxygen (ml/l): 4.509 - 4.641
  Phosphate (umol/l): 0.137 - 0.168
  Silicate (umol/l): 1.182 - 3.868

Graphical representation

Depth range (m): 5 - 35

Temperature range (°C): 27.844 - 29.205

Nitrate (umol/L): 0.068 - 0.678

Salinity (PPS): 34.393 - 34.586

Oxygen (ml/l): 4.509 - 4.641

Phosphate (umol/l): 0.137 - 0.168

Silicate (umol/l): 1.182 - 3.868
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 3 - 40m.
From 3 to 40 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs in coral rich areas of clear lagoons, channels, and protected outer reef slopes. Often solitary. Feeds on sponges and tunicates.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 15 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pomacanthus navarchus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTCTATTTACTATTTGGTGCTTGAGCCGGAATAGTGGGCACTGCTTTAAGCCTACTAATTCGAGCCGAACTAAATCAACCAGGCAGTCTTCTCGGGGACGACCAAATCTACAATGTTATCGTTACAGCACACGCATTCGTAATAATTTTTTTTATAGTAATACCAGCTATAATTGGAGGCTTCGGGAACTGACTAGTTCCACTAATGATTGGAGCCCCAGACATGGCATTCCCTCGAATAAATAACATAAGCTTTTGACTCCTGCCTCCTTCCCTTCTTCTCCTCCTCGCTTCCGCTGGGGTAGAAGCCGGAGCTGGGACCGGATGAACAGTTTACCCGCCCCTAGCCGGCAATCTGGCCCATGCAGGAGCATCTGTAGATTTAACCATCTTCTCTCTTCATTTAGCTGGGATCTCCTCAATTCTTGGAGCCATTAACTTTATTACAACCATTATTAATATGAAACCCCCCGCTATTTCACAGTATCAAACTCCGCTATTTGTATGAGCAGTCCTAATCACCGCAGTTCTTCTCCTTCTTTCTCTCCCCGTCCTTGCTGCCGGCATTACAATGCTTCTTACAGACCGAAATCTAAACACCACCTTTTTTGACCCCGCAGGAGGAGGAGACCCAATCCTTTACCAACA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pomacanthus navarchus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Pyle, R., Rocha, L.A. & Craig, M.T.

Reviewer/s
Elfes, C., Polidoro, B., Livingstone, S. & Carpenter, K.E.

Contributor/s

Justification
Listed as Least Concern as this is a widely distributed and common species, with apparently stable populations and no major threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
It is generally common with stable populations.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats

There appear to be no major threats to this species. Collection for aquarium trade does not seem to influence the global population.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

There are no species-specific conservation measures. It occurs within several marine protected areas throughout its wide range.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: subsistence fisheries; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pomacanthus navarchus

Blue-girdled angelfish, Pomacanthus navarchus is a marine angelfish from the Indo-Pacific ocean as well as some parts of the east Indian Ocean. It occasionally makes its way into the aquarium trade. The Majestic Angelfish is one of the smallest of the larger species of angelfish. It grows to a size of 41 centimetres (16 in) in length and can live to be up to 21 years old. Younger fish stay closer to the shallows, but the more mature fish can be found up to 120 feet (37 m) deep. Majestic Angelfish eat mainly sponges and tunicates. Juvenile fish are mostly blue in color with white stripes. As they mature, they take on a yellow coloration on the flanks, dorsal fin, and tail as seen in the image at right.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!