Pomacanthus navarchus — Details

Young Blue Girdled Angel learn more about names for this taxon

Overview

Comprehensive Description

Biology

Learn more about this article

Occurs in coral rich areas of clear lagoons, channels, and protected outer reef slopes. Changes to adult pattern is dramatic, and intermediate stage are rarely seen (Ref. 48636). Often solitary. Feeds on sponges and tunicates. Uncommon (Ref. 9710). Highly prized aquarium export (Ref. 37816).

Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602) http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Distribution

Learn more about this article

Indo-Pacific: Indonesia to Papua New Guinea, north to the Philippines, south to Rowley Shoals and the southern Great Barrier Reef; including Palau and Yap in Micronesia.

Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602) http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Range Description

Learn more about this article

This species is found throughout the Indo-Australian Archipelago and western edge of Micronesia, including Rowley Shoals (off Western Australia), New Guinea (Indonesia and Papua New Guinea), the Solomon Islands, northwards to the Philippines Islands, Palau and Yap Island (Federated States of Micronesia) (Pyle 2001, G.R. Allen pers. comm. 2006). It is found at depths of 3-40 m.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

West Pacific and southeastern Indian Ocean.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Physical Description

Morphology

Learn more about this article

Dorsal spines (total): 13 - 14; Dorsal soft rays (total): 17 - 18; Analspines: 3; Analsoft rays: 18

Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602) http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Size

Learn more about this article

Maximum size: 280 mm NG

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Max. size

Learn more about this article

28.0 cm TL (male/unsexed; (Ref. 9710)); max. reported age: 15 years (Ref. 72479)

Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710) http://www.fishbase.org/references/FBRefSummary.php?id=9710&speccode=13770
Hinton 1962 Horned shark, gar, mormyriad, characin, carp, armored catfish, arowana, upside down catfish. Not given. (Ref. 72479) http://www.fishbase.org/references/FBRefSummary.php?id=72479&speccode=5564

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Diagnostic Description

Learn more about this article

Juveniles black with light blue curve vertical stripes on the sides. Adults are bright yellow on sides and back, dorsal and caudal fins, with numerous blue spots; head and ventral portion of the body, pectoral and pelvic fins dark blue with numerous light blue spots on the posterior portion of the anal fin and the adjacent caudal peduncle area. Narrow light blue streaks run across the face from below the eye, and on the area just behind the head. Fins edged light blue.

Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602) http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Ecology

Habitat

Environment

Learn more about this article

reef-associated; non-migratory; marine; depth range 3 - 40 m (Ref. 9710)

Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710) http://www.fishbase.org/references/FBRefSummary.php?id=9710&speccode=13770

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Habitat and Ecology

Learn more about this article

Habitat and Ecology

This species is associated with areas of rich coral growth in lagoons, channels and on outer reef slopes. The juveniles are mostly in shallow protected reef areas. Usually solitary or in pairs. The diet is comprised mostly of sponges and tunicates (Pyle 2001).

Systems

Marine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Depth range based on 5 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 5 - 35
  Temperature range (°C): 27.844 - 29.205
  Nitrate (umol/L): 0.068 - 0.678
  Salinity (PPS): 34.393 - 34.586
  Oxygen (ml/l): 4.509 - 4.641
  Phosphate (umol/l): 0.137 - 0.168
  Silicate (umol/l): 1.182 - 3.868

Graphical representation

Depth range (m): 5 - 35

Temperature range (°C): 27.844 - 29.205

Nitrate (umol/L): 0.068 - 0.678

Salinity (PPS): 34.393 - 34.586

Oxygen (ml/l): 4.509 - 4.641

Phosphate (umol/l): 0.137 - 0.168

Silicate (umol/l): 1.182 - 3.868

Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Public Domain

Source: Ocean Biogeographic Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Depth: 3 - 40m.
From 3 to 40 meters.

Habitat: reef-associated.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Trophic Strategy

Learn more about this article

Occurs in coral rich areas of clear lagoons, channels, and protected outer reef slopes. Often solitary. Feeds on sponges and tunicates.

Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602) http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Learn more about this article

Maximum longevity: 15 years (wild)

Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pomacanthus navarchus

Learn more about this article

The following is a representative barcode sequence, the centroid of all available sequences for this species.

There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.

CCTCTATTTACTATTTGGTGCTTGAGCCGGAATAGTGGGCACTGCTTTAAGCCTACTAATTCGAGCCGAACTAAATCAACCAGGCAGTCTTCTCGGGGACGACCAAATCTACAATGTTATCGTTACAGCACACGCATTCGTAATAATTTTTTTTATAGTAATACCAGCTATAATTGGAGGCTTCGGGAACTGACTAGTTCCACTAATGATTGGAGCCCCAGACATGGCATTCCCTCGAATAAATAACATAAGCTTTTGACTCCTGCCTCCTTCCCTTCTTCTCCTCCTCGCTTCCGCTGGGGTAGAAGCCGGAGCTGGGACCGGATGAACAGTTTACCCGCCCCTAGCCGGCAATCTGGCCCATGCAGGAGCATCTGTAGATTTAACCATCTTCTCTCTTCATTTAGCTGGGATCTCCTCAATTCTTGGAGCCATTAACTTTATTACAACCATTATTAATATGAAACCCCCCGCTATTTCACAGTATCAAACTCCGCTATTTGTATGAGCAGTCCTAATCACCGCAGTTCTTCTCCTTCTTTCTCTCCCCGTCCTTGCTGCCGGCATTACAATGCTTCTTACAGACCGAAATCTAAACACCACCTTTTTTGACCCCGCAGGAGGAGGAGACCCAATCCTTTACCAACA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Statistics of barcoding coverage: Pomacanthus navarchus

Learn more about this article

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Conservation

Conservation Status

IUCN Red List Assessment

Learn more about this article

Red List Category

LC

Least Concern

Red List Criteria

Version

3.1

Year Assessed

2010

Assessor/s

Pyle, R., Rocha, L.A. & Craig, M.T.

Reviewer/s

Elfes, C., Polidoro, B., Livingstone, S. & Carpenter, K.E.

Contributor/s

Justification

Listed as Least Concern as this is a widely distributed and common species, with apparently stable populations and no major threats.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Trends

Population

Learn more about this article

Population

It is generally common with stable populations.

Population Trend

Stable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Threats

Learn more about this article

Least Concern (LC)

IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006. http://www.fishbase.org/references/FBRefSummary.php?id=57073

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Major Threats

There appear to be no major threats to this species. Collection for aquarium trade does not seem to influence the global population.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Management

Conservation Actions

Learn more about this article

Conservation Actions

There are no species-specific conservation measures. It occurs within several marine protected areas throughout its wide range.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Relevance to Humans and Ecosystems

Benefits

Importance

Learn more about this article

fisheries: subsistence fisheries; aquarium: commercial

Steene, R.C. 1978 Butterfly and angelfishes of the world. A.H. & A.W. Reed Pty Ltd., Australia. vol. 1. 144 p. (Ref. 4859) http://www.fishbase.org/references/FBRefSummary.php?id=4859&speccode=6515
Hermes, R. 1993 Species composition of small-scale fish landings in Lae, Papua New Guinea. Naga ICLARM Q. 16(2&3):38. (Ref. 13370) http://www.fishbase.org/references/FBRefSummary.php?id=13370&speccode=5661

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Wikipedia

Pomacanthus navarchus

Learn more about this article

Blue-girdled angelfish, Pomacanthus navarchus is a marine angelfish from the Indo-Pacific ocean as well as some parts of the east Indian Ocean. It occasionally makes its way into the aquarium trade. The Majestic Angelfish is one of the smallest of the larger species of angelfish. It grows to a size of 41 centimetres (16 in) in length and can live to be up to 21 years old. Younger fish stay closer to the shallows, but the more mature fish can be found up to 120 feet (37 m) deep. Majestic Angelfish eat mainly sponges and tunicates. Juvenile fish are mostly blue in color with white stripes. As they mature, they take on a yellow coloration on the flanks, dorsal fin, and tail as seen in the image at right.

References

Froese, Rainer, and Daniel Pauly, eds. (2008). "Pomacanthus navarchus" in FishBase. December 2008 version.
Schiemer, Gregory (July 2005). "Aquarium Fish: Pomacanthus navarchus - The Majestic Angelfish". Advanced Aquarist. Pomacanthus Publications, LLC. http://www.advancedaquarist.com/2005/7/fish. Retrieved 2012-01-06.

This Perciformes article is a stub. You can help Wikipedia by expanding it.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!