Overview

Comprehensive Description

Biology

Inhabits continental shelf reefs; not usually found around oceanic islands (Ref. 9710). Feeds on sponges, tunicates, and filamentous algae (Ref. 9710). Forms small groups. Frequently exported through the aquarium trade (Ref. 48391). Very close to Chaetodontoplus poliourus Randall & Rocha, 2009 with different colors on pelvic, dorsal and caudal fins. The two species coexist in several islands of Indonesia (Ref. 82330) including Lesser Sunda Islands, Molucca Islands, Halmahera, and Bird's Head Peninsula of West Papua (Ref. 90102).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is distributed in the western Indo-Pacific region, where it ranges from Japan in the north to Indonesia (including the Mentawai Islands), east to the Bird's Head Peninsula (Randall and Rocha 2009) of New Guinea, and southward to northern Australia (Pyle 2001). It has been recorded between 1-20 m in depth.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: Japan to Indonesia, Sri Lanka and east to Papua New Guinea (Ref. 4859). Reported from Mentawai Islands (Ref. 27157). May consist of two separate species, one with an all-yellow tail and the other mostly gray tail (Ref. 48391).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Pacific and eastern Indian Ocean.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 12; Dorsal soft rays (total): 17 - 18; Analspines: 3; Analsoft rays: 17 - 18
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 180 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

18.0 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description: Body purplish grey with vermiculations white, snout tip yellow, eye bar black, patch on nape white or yellow. Body depth 1.7-1.8 in SL. Scales longitudinal series about 80 (Ref. 90102). May consist of two separate species, one with an all-yellow tail and the other mostly gray tail (Ref. 48391, 48636).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is found in areas of rich coral growth on silty inner coastal reefs and lagoons. Adults occur alone or in pairs. Feeds on sponges, tunicates and algae (G.R. Allen pers. comm. 2006).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 25 specimens in 1 taxon.
Water temperature and chemistry ranges based on 18 samples.

Environmental ranges
  Depth range (m): 3 - 53
  Temperature range (°C): 27.072 - 28.897
  Nitrate (umol/L): 0.062 - 2.007
  Salinity (PPS): 32.276 - 34.534
  Oxygen (ml/l): 4.130 - 4.660
  Phosphate (umol/l): 0.057 - 0.380
  Silicate (umol/l): 1.202 - 7.448

Graphical representation

Depth range (m): 3 - 53

Temperature range (°C): 27.072 - 28.897

Nitrate (umol/L): 0.062 - 2.007

Salinity (PPS): 32.276 - 34.534

Oxygen (ml/l): 4.130 - 4.660

Phosphate (umol/l): 0.057 - 0.380

Silicate (umol/l): 1.202 - 7.448
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; non-migratory; marine; depth range 1 - 20 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 25 specimens in 1 taxon.
Water temperature and chemistry ranges based on 18 samples.

Environmental ranges
  Depth range (m): 3 - 53
  Temperature range (°C): 27.072 - 28.897
  Nitrate (umol/L): 0.062 - 2.007
  Salinity (PPS): 32.276 - 34.534
  Oxygen (ml/l): 4.130 - 4.660
  Phosphate (umol/l): 0.057 - 0.380
  Silicate (umol/l): 1.202 - 7.448

Graphical representation

Depth range (m): 3 - 53

Temperature range (°C): 27.072 - 28.897

Nitrate (umol/L): 0.062 - 2.007

Salinity (PPS): 32.276 - 34.534

Oxygen (ml/l): 4.130 - 4.660

Phosphate (umol/l): 0.057 - 0.380

Silicate (umol/l): 1.202 - 7.448
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 20m.
From 1 to 20 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits continental shelf reefs; not usually found around oceanic islands. Feeds on sponges, tunicates, and filamentous algae (Ref. 1602).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chaetodontoplus mesoleucus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTCTACCTCCTGTTTGGTGCCTGGGCCGNGATAGTAGGCACGGCGTTAAGCCTGCTAATCCGAGCTGAGCTCAATCAGCCTGGCAGCCTTCTTGGGGATGACCAGATTTACAATGTTATCGTTACAGCGCATGCATTTGTAATAATTTTCTTTATAGTAATGCCAGCCATGATTGGGGGATTCGGAAACTGACTAGTCCCGCTGATAATCGGAGCACCCGACATAGCGTTCCCTCGAATAAACAACATAAGCTTCTGGCTCCTGCCTCCCTCACTCCTTCTTCTCCTCGCTTCCGCAGGCGTAGAGGCTGGGGCCGGTACCGGGTGGACAGTCTACCCTCCTCTTGCCGGCAACCTAGCCCACGCGGGAGCATCCGTAGACCTAACCATCTTTTCCCTCCACCTAGCCGGAGTCTCTTCCATCCTGGGGGCCATTAACTTCATTACCACCATCATCAACATGAAACCTCCCGCAACCTCCCAGTATCAAACGCCCCTGTTTGTCTGAGCAGTTCTAATTACTGCCGTCCTTCTTCTTCTTTCTCTACCAGTACTCGCTGCCGGAATCACTATACTTCTTACAGACCGAAATCTAAACACCACCTTCTTCGACCCAGCCGGTGGGGGAGATCCGATTCTTTACCAACATTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Chaetodontoplus mesoleucus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Pyle, R., Myers, R., Rocha, L.A. & Craig, M.T.

Reviewer/s
Elfes, C., Polidoro, B., Livingstone, S. & Carpenter, K.E.

Contributor/s

Justification

Listed as Least Concern in view of its wide distribution, presumed large overall population and no apparent major threats.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population

It is generally common with stable populations.


Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats

There appear to be no major threats to this species. Collecting is not considered to be impacting the global population.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

There appear to be no species-specific conservation measures in place. This species is present within a number of marine protected areas throughout its range.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Chaetodontoplus mesoleucus

Chaetodontoplus mesoleucus, also known as the Red Sea Butterflyfish is a member of the Pomacanthidae family.[1]

Habitat[edit]

This species can be found in costal reefs with rich coral growth.[1]

Human use[edit]

This species is exported for use in aquariums, and is one of the most popular aquarium species.[1]

References[edit]

  1. ^ a b c "Chaetodontoplus mesoleucus". Iucnredlist.org. Retrieved 26 October 2014. 


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!