Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Found in shallow exposed reef flats, usually with rock-base and mixed coral and algae (Ref. 48636, 58302). Also occurs in surge-swept reef flats, reef margins, and clear rocky shorelines, but may venture to deeper waters up to 10 m (Ref. 3921). Benthopelagic (Ref. 58302). Feeds on crustaceans (especially crabs), mollusks, and ophiuroids (brittle stars) (Ref. 3921).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is widespread and occurs throughout much of the Indo-West central Pacific region (Allen and Adrim 2003). It is found from East Africa in the western Indian Ocean to the Pitcairn Islands in the east, the Ryukyu Islands (southern Japan) in the north (Senou et al. 2007), and Rapa Island in the south Pacific Ocean.

This species was recorded from Bali, Komodo, Togean and Banggai Islands and Pulau Weh, with an Indonesian distribution from Papua to Sumatra (Allen and Adrim 2003). It is also known from the Spratly Islands (Nguyen and Nguyen 2006). It was recorded in Malaysia (Anon 1987), Indonesia and the Philippines (Myers 1991).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific: Transkei (South Africa) and East Africa, Seychelles and western Mascaranes east to Hawaiian Islands and Pitcairn Group, north to Ryukyu Islands and Ogasawara Islands, south to New Caledonia, Kermadec Islands, Tonga and Rapa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-Pacific: East Africa to the Pitcairn, north to the Ryukyu Islands, south to Tonga and Rapa.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 8; Dorsal soft rays (total): 12 - 14; Analspines: 3; Analsoft rays: 10 - 12
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 300 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

30.0 cm TL (male/unsexed; (Ref. 4392))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Occurs in surge-swept reef flats, reef margins, and rocky shorelines, but may venture to deeper waters up to 10 m. Feeds on crustaceans (especially crabs), molluscs, and ophiuroids (brittle stars).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The primary phase of this wrasse is almost indistinguishable from that of T. purpureum. But head of male T. trilobatum plain brown to orange or shaded with blue. Female most difficult and has a more spotted and shorter head. It lacks the 'V' on the snout that shows clearly on the T. purpureum (Ref. 48636). Initial phase with a diagonal dark red line below front of eye (Ref 9823).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is generally found inshore (Randall 1985), over shallow exposed reef flats, usually with rock-base and mixed coral and algae (Kuiter and Tonozuka 2001, Mundy 2005). It also occurs on surge-swept reef flats, reef margins, and clear rocky shorelines, but may venture into deeper waters up to 10 m depth (Randall 1985). It is benthopelagic (Mundy 2005). Habitats include seagrass beds and coral reefs in the Spratly Islands (Nguyen and Nguyen 2006).

The primary phase of this wrasse is almost indistinguishable from that of T. purpureum. The head of the male of T. trilobatum is plain brown to orange or shaded with blue. The female has a more spotted and shorter head which lacks the distinct 'V' on the snout that shows clearly on the female of T. purpureum (Kuiter and Tonozuka 2001). The initial phase has a dark diagonal red line below the front of the eye (Westneat 2001).

This species feeds on crustaceans (especially crabs), molluscs, and ophiuroids (brittle stars) (Randall 1985). Diet at recruit/juvenile stage is mainly zoobenthos and smaller nekton (Hobson 1974).The larval duration is 78.3 (s.d. +/- 12.3) days, range is 60-99 (Victor 1986).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 10m.
Recorded at 10 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range 0 - 10 m (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 47 specimens in 1 taxon.
Water temperature and chemistry ranges based on 41 samples.

Environmental ranges
  Depth range (m): 0.08 - 150
  Temperature range (°C): 24.633 - 29.115
  Nitrate (umol/L): 0.043 - 0.555
  Salinity (PPS): 34.109 - 35.547
  Oxygen (ml/l): 4.503 - 4.851
  Phosphate (umol/l): 0.092 - 0.284
  Silicate (umol/l): 0.829 - 6.035

Graphical representation

Depth range (m): 0.08 - 150

Temperature range (°C): 24.633 - 29.115

Nitrate (umol/L): 0.043 - 0.555

Salinity (PPS): 34.109 - 35.547

Oxygen (ml/l): 4.503 - 4.851

Phosphate (umol/l): 0.092 - 0.284

Silicate (umol/l): 0.829 - 6.035
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Thalassoma trilobatum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACTCTCTACCTTGTATTCGGCGCATGAGCTGGGATAGTAGGGACAGCCCTAAGCCTGCTCATTCGGGCAGAATTGAGCCAGCCCGGCGCCCTCCTTGGAGACGACCAGATTTATAACGTCATCGTCACAGCCCATGCATTTGTCATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGATTCGGGAACTGACTAATTCCCCTAATGATTGGGGCCCCCGATATGGCCTTCCCTCGTATAAACAACATGAGCTTTTGGCTTCTTCCCCCTTCATTCCTCCTCCTTCTCGCTTCTTCTGGCGTTGAAGCGGGGGCCGGAACTGGATGAACAGTTTACCCGCCGCTAGCAGGTAACCTTGCCCACGCTGGCGCATCCGTTGACCTCACTATCTTCTCCTTACATCTAGCGGGCATTTCATCAATTTTAGGTGCAATTAACTTTATTACAACCATTATCAACATAAAACCCCCAGCCGTCTCTCAATATCAGACGCCTCTTTTCGTGTGAGCCGTTCTGATCACAGCAGTCCTTCTTCTACTCTCTCTTCCAGTGCTTGCTGCCGGCATTACAATGCTCCTGACGGACCGAAACCTAAACACTACCTTCTTTGACCCTGCTGGACGAGGGGACCCCATTCTTTATCAACATCTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Thalassoma trilobatum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 33
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Cabanban, A. & Pollard, D.

Reviewer/s
Craig, M.T. & Carpenter, K.E.

Contributor/s

Justification
This species is very widespread throughout much of the Indo-Pacific region. Although there are some localized threats to its populations from overfishing and marine pollution, it is protected in a number of marine parks throughout parts of its wide distribution. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is rare based on reports from Indonesia (Kuiter and Tonozuka 2001) and it was only found in two out of 19 sites surveyed in Banda Flores, Indonesia (Mous 2002). In the Philippines, this species is only found at a few locations and is considered relatively uncommon (V. Hilomen pers. comm.).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are no major threats to this species. Localized threats may include overfishing and habitat destruction from pollution and blast-fishing in some parts of its range in SE Asia (Hodgson 1999, Burke et al. 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for this species. However, its distribution overlaps several marine protected areas within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: very high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Thalassoma trilobatum

The Christmas wrasse, Thalassoma trilobatum, is a species of wrasse native to the Indian Ocean and the western Pacific Ocean. It inhabits shallow reefs at depths from the surface to 10 m (33 ft). This species can reach 30 cm (12 in) in total length. It is of minor importance to local commercial fisheries and can be found in the aquarium trade.[2]

References[edit]

  1. ^ Cabanban, A. & Pollard, D. 2010. Thalassoma trilobatum. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 17 November 2013.
  2. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Thalassoma trilobatum" in FishBase. October 2013 version.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!