Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Found solitary or in groups (Ref. 90102) in shallow exposed reef flats, usually with rock-base and mixed coral and algae (Ref. 48636, 58302). Also occurs in surge-swept reef flats, reef margins, and clear rocky shorelines, but may venture to deeper waters up to 10 m (Ref. 3921). Benthopelagic (Ref. 58302). Feeds on crustaceans (especially crabs), mollusks, and ophiuroids (brittle stars) (Ref. 3921).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-West Pacific: Transkei (South Africa) and East Africa, Seychelles and western Mascaranes east to Hawaiian Islands and Pitcairn Group, north to Ryukyu Islands and Ogasawara Islands, south to New Caledonia, Kermadec Islands, Tonga and Rapa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: East Africa to the Pitcairn, north to the Ryukyu Islands, south to Tonga and Rapa.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 8; Dorsal soft rays (total): 12 - 14; Analspines: 3; Analsoft rays: 10 - 12
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 300 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

30.0 cm TL (male/unsexed; (Ref. 4392))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Occurs in surge-swept reef flats, reef margins, and rocky shorelines, but may venture to deeper waters up to 10 m. Feeds on crustaceans (especially crabs), molluscs, and ophiuroids (brittle stars).
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The primary phase of this wrasse is almost indistinguishable from that of T. purpureum. But head of male T. trilobatum plain brown to orange or shaded with blue. Female most difficult and has a more spotted and shorter head. It lacks the 'V' on the snout that shows clearly on the T. purpureum (Ref. 48636). Initial phase with a diagonal dark red line below front of eye (Ref 9823).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 47 specimens in 1 taxon.
Water temperature and chemistry ranges based on 41 samples.

Environmental ranges
  Depth range (m): 0.08 - 150
  Temperature range (°C): 24.633 - 29.115
  Nitrate (umol/L): 0.043 - 0.555
  Salinity (PPS): 34.109 - 35.547
  Oxygen (ml/l): 4.503 - 4.851
  Phosphate (umol/l): 0.092 - 0.284
  Silicate (umol/l): 0.829 - 6.035

Graphical representation

Depth range (m): 0.08 - 150

Temperature range (°C): 24.633 - 29.115

Nitrate (umol/L): 0.043 - 0.555

Salinity (PPS): 34.109 - 35.547

Oxygen (ml/l): 4.503 - 4.851

Phosphate (umol/l): 0.092 - 0.284

Silicate (umol/l): 0.829 - 6.035
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 10m.
Recorded at 10 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 0 - 10 m (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 47 specimens in 1 taxon.
Water temperature and chemistry ranges based on 41 samples.

Environmental ranges
  Depth range (m): 0.08 - 150
  Temperature range (°C): 24.633 - 29.115
  Nitrate (umol/L): 0.043 - 0.555
  Salinity (PPS): 34.109 - 35.547
  Oxygen (ml/l): 4.503 - 4.851
  Phosphate (umol/l): 0.092 - 0.284
  Silicate (umol/l): 0.829 - 6.035

Graphical representation

Depth range (m): 0.08 - 150

Temperature range (°C): 24.633 - 29.115

Nitrate (umol/L): 0.043 - 0.555

Salinity (PPS): 34.109 - 35.547

Oxygen (ml/l): 4.503 - 4.851

Phosphate (umol/l): 0.092 - 0.284

Silicate (umol/l): 0.829 - 6.035
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Thalassoma trilobatum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACTCTCTACCTTGTATTCGGCGCATGAGCTGGGATAGTAGGGACAGCCCTAAGCCTGCTCATTCGGGCAGAATTGAGCCAGCCCGGCGCCCTCCTTGGAGACGACCAGATTTATAACGTCATCGTCACAGCCCATGCATTTGTCATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGATTCGGGAACTGACTAATTCCCCTAATGATTGGGGCCCCCGATATGGCCTTCCCTCGTATAAACAACATGAGCTTTTGGCTTCTTCCCCCTTCATTCCTCCTCCTTCTCGCTTCTTCTGGCGTTGAAGCGGGGGCCGGAACTGGATGAACAGTTTACCCGCCGCTAGCAGGTAACCTTGCCCACGCTGGCGCATCCGTTGACCTCACTATCTTCTCCTTACATCTAGCGGGCATTTCATCAATTTTAGGTGCAATTAACTTTATTACAACCATTATCAACATAAAACCCCCAGCCGTCTCTCAATATCAGACGCCTCTTTTCGTGTGAGCCGTTCTGATCACAGCAGTCCTTCTTCTACTCTCTCTTCCAGTGCTTGCTGCCGGCATTACAATGCTCCTGACGGACCGAAACCTAAACACTACCTTCTTTGACCCTGCTGGACGAGGGGACCCCATTCTTTATCAACATCTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Thalassoma trilobatum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 33
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: very high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Thalassoma trilobatum

The Christmas wrasse, Thalassoma trilobatum, is a species of wrasse native to the Indian Ocean and the western Pacific Ocean. It inhabits shallow reefs at depths from the surface to 10 m (33 ft). This species can reach 30 cm (12 in) in total length. It is of minor importance to local commercial fisheries and can be found in the aquarium trade.[2]

References[edit]

  1. ^ Cabanban, A. & Pollard, D. 2010. Thalassoma trilobatum. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 17 November 2013.
  2. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Thalassoma trilobatum" in FishBase. October 2013 version.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!