Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Found in clear outer lagoon reefs (Ref. 9710) and exposed seaward reefs. Abundant in shallow exposed areas with surge channels (Ref. 9710, 48636), with gutters, large Acropora plates and algae bottom (Ref. 48636). Benthopelagic (Ref. 58302). Males are often in small loose numbers, swimming over reef sections where small groups of females stay close to the bottom. Juveniles secretive in shallow gutters (Ref. 48636). Feed mainly on benthic crustaceans (crabs, shrimps), small fishes, gastropod mollusks, and sea urchins.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is found in the Indo-Pacific from East Africa to the Hawaiian, Marquesas and Tuamoto Islands, north to the Ryukyu Islands, and south to the Cook Islands and Lord Howe Island off eastern Australia (Randall 1990, Senou et al. 2007). It has been reported to occur in the Gulf of Aden (Kemp 2000).

It is replaced by Thalassoma cupido from southern Japan to Taiwan, Thalassoma heiseri in the Pitcairn Islands, and Thalassoma loxum in Oman (Myers 1999). It reportedly hybridizes with Thalassoma jansenii in the Banda Sea, Indonesia, and with Thalassoma nigrofasciatum at Holmes Reef in the Coral Sea (Walsh and Randall 2004).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific: East Africa and South Africa east to Hawaiian Islands and Easter Island, north to Ryukyu Islands and Ogasawara Islands, south to Western Australia, Lord Howe Island, New Calewdonia and Tonga.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-Pacific: East Africa to the Hawaiian, Marquesan, and Tuamoto islands, north to the Ryukyu Islands. Replaced by Thalassoma cupido from southern Japan to Taiwan, Thalassoma heiseri in Pitcairn, and Thalassoma loxum at Oman (Ref. 37816). Reported hybrids with Thalassoma jansenii in Banda Sea, Indonesia and with Thalassoma nigrofasciatum in Holmes Reef, Coral Sea (Ref. 57554).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific: East Africa and South Africa east to Hawaiian Islands and Easter Island, north to Ryukyu Islands and Ogasawara Islands, south to Western Australia, Lord Howe Island, New Calewdonia and Tonga.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 8; Dorsal soft rays (total): 12 - 14; Analspines: 3; Analsoft rays: 10 - 12
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 170 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

17.0 cm TL (male/unsexed; (Ref. 4392))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Males display with brilliant colors, red lines turning purple and often the abdomen bright yellow (Ref. 48636). Two uneven red stripes on dorsal half of body, 1 from below dorsal-fin origin onto upper caudal lobe, the other from above pectoral-fin base to caudal peduncle. Pectoral fins with green base and dark pectoral fins (Ref 9823).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is found on clear outer lagoon reefs (Lieske and Myers 1994) and exposed seaward reefs. It is abundant in shallow exposed areas with surge channels (Lieske and Myers 1994, Kuiter and Tonozuka 2001), and in gutters, around large Acropora plates and on algal bottoms (Kuiter and Tonozuka 2001). It is benthopelagic (Mundy 2005).

Males are often found in small loose groups, swimming over reef sections where small groups of females stay close to the bottom. Juveniles are secretive in shallow gutters (Kuiter and Tonozuka 2001). It feeds mainly on benthic crustaceans (crabs, shrimps), small fishes, gastropod molluscs and sea urchins.

It forms spawning groups (Collin and Bell 1991) at ~1 m depth (Craig 1998), along channels or passages and around promontories or bommies (Collin and Bell 1991, Craig 1998), and at down-current margins of reefs (Craig 1998). Larval duration is 56.4 (s.d. +/- 7.9) days, range 46-68 days (Victor 1986).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range 0 - 40 m (Ref. 2334)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 121 specimens in 1 taxon.
Water temperature and chemistry ranges based on 106 samples.

Environmental ranges
  Depth range (m): 0.305 - 22
  Temperature range (°C): 25.198 - 29.336
  Nitrate (umol/L): 0.025 - 2.714
  Salinity (PPS): 33.821 - 36.148
  Oxygen (ml/l): 4.450 - 4.806
  Phosphate (umol/l): 0.085 - 0.507
  Silicate (umol/l): 0.829 - 4.892

Graphical representation

Depth range (m): 0.305 - 22

Temperature range (°C): 25.198 - 29.336

Nitrate (umol/L): 0.025 - 2.714

Salinity (PPS): 33.821 - 36.148

Oxygen (ml/l): 4.450 - 4.806

Phosphate (umol/l): 0.085 - 0.507

Silicate (umol/l): 0.829 - 4.892
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 40m.
Recorded at 40 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Found in clear outer lagoon reefs and exposed seaward reefs. Abundant in shallow exposed areas with surge channels. Feeds mainly on benthic crustaceans (crabs, shrimps), small fishes, gastropod molluscs, and sea urchins.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Pelagic spawner.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Thalassoma quinquevittatum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 29
Specimens with Barcodes: 48
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Thalassoma quinquevittatum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 22 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CATAAAGATATTGGCACCCTCTATCTTGTGTTCGGCGCATGAGCCGGGATAGTGGGTACAGCCCTGAGCCTGCTCATTCGAGCTGAGCTAAGCCAGCCCGGCGCCCTCCTTGGAGAC---GATCAGATCTATAACGTCATCGTTACAGCCCATGCATTTGTCATAATTTTCTTTATAGTAATACCAATTATGATCGGAGGCTTCGGAAACTGACTTATTCCCCTAATGATTGGGGCCCCTGACATGGCCTTCCCTCGTATGAACAACATAAGCTTTTGACTTCTTCCCCCATCATTCCTCCTACTTCTTGCCTCTTCCGGTGTTGAAGCGGGGGCCGGAACCGGGTGAACTGTCTACCCGCCCTTGGCAGGTAACCTCGCCCACGCTGGTGCATCCGTCGACCTTACTATTTTTTCCCTACACCTGGCGGGTATCTCATCAATCCTAGGTGCAATTAACTTCATTACGACCATCATCAATATGAAACCCCCAGCCATCTCCCAATATCAGACGCCTCTTTTCGTATGAGCCGTCCTGATTACAGCAGTCCTCCTTCTCCTCTCTCTCCCTGTTCTAGCTGCTGGTATTACAATGCTCCTAACGGACCGAAATCTAAACACCACCTTCTTTGACCCTGCCGGAGGGGGGGACCCAATTCTTTACCAACACCTATTCTGATTTTTTGGTCAC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Cabanban, A. & Pollard, D.

Reviewer/s
Craig, M.T. & Carpenter, K.E.

Contributor/s

Justification
Although there are existing localized threats, and particularly exploitation for the commercial aquarium fish industry and destruction of coral reef habitats within parts of its range, this species is widespread and is found in Marine Protected Areas throughout parts of its range. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is common in at least parts of its range. For example, it is common in Banda Islands, Maluku, East Indonesia, where it was found in 10 out of the 19 sites surveyed (Mous 2002). It is occasional (but more common in sites exposed to tidal surges) in Solomon Islands (Allen et al. 2006).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are no major threats to this species. Localized threats to the species in some parts of southeast Asia are overfishing for the marine aquarium fish industry and coral habitat destruction from pollution and blast-fishing (Hodgson 1999, Burke et al. 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for this species. However, its distribution overlaps several marine protected areas within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Thalassoma quinquevittatum

The fivestripe wrasse, Thalassoma quinquevittatum, is a species of wrasse native to the Indian Ocean and the western Pacific Ocean. It is an inhabitant of coral reefs in quite shallow water of 1 to 5 m (3.3 to 16 ft) in depth. It seems to particularly like areas with surge channels, plentiful algal growth, and Acropora coral plates. It can reach 17 cm (6.7 in) in total length. This species can be found in the aquarium trade.[2]

References[edit]

  1. ^ Cabanban, A. & Pollard, D. 2010. Thalassoma quinquevittatum. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 17 November 2013.
  2. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Thalassoma quinquevittatum" in FishBase. October 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!