Articles on this page are available in 2 other languages: Spanish (1), Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Description

  Common names: wrasse (English), vieja (Espanol)
 
Thalassoma purpureum (Forsskål, 1775)

Surge wrasse

Elongate (body of large adults relatively deep (~ 36% of SL)), compressed body; 1 pair canines at front of top jaw, 1 pair on bottom, none at rear of jaws; preopercle edge smooth; dorsal fin VIII, 13; anal rays III, 11; pectoral rays 15-17; tail fin bluntly straight; lateral line unbroken, but bends abruptly down near end of soft dorsal fin; scales large (25 on lateral line), smooth; head scaleless except for a few scales on upper operculum.


Head and body green; a red V on snout before eye, 2 oblique red bars from eye down across operculum; 2 red stripes along flank; sides with thin irregular red vertical lines following scale edges; dorsal and anal green with red bands along bases; large males -  base color is blue-green to blue, red bars on head and 2 red stripes along side greatly intensified.


Size: 46 cm.

Habitat: wave swept rocky habitat.

Depth: 0-20 m.

An Indo-Pacific species found at Cocos, Clipperton, the Galapagos, the Gulf of Chiriqui, Panama, and around the Bat Islands, western Costa Rica.
   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Found almost exclusively in the surge zone of outer reef flats, reef margins, and rocky coastlines, down to a depth of about 10 m (Ref. 5213). Benthopelagic (Ref. 58302). Occur in groups of females that are spread out over large reef sections and dominated by few males. Males grow much larger than females (Ref. 48636). Feed on small invertebrates (crabs, sea urchins, brittlestars, mollusks), small fishes, echinoids, ophiuroids and polychaetes (Ref. 37816). Protogynous (Ref. 55080).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is widely distributed in the Indo-Pacific, as it occurs from East Africa and the Red Sea to central America. It is replaced by Thalassoma virens in the Revillagigedo Islands (Myers 1999). This species is also recorded in Pohnpei (G. Allen unpublished survey).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, TEP non-endemic, Indo-Pacific only (Indian + Pacific Oceans), "Transpacific" (East + Central &/or West Pacific), All Pacific (West + Central + East)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: Red Sea and East Africa (Ref. 4392) to the Hawaiian, Marquesan, and Easter islands, north to southern Japan, south to Lord Howe, Kermadec, and Rapa islands. Southeast Atlantic: southeast coast of South Africa (Ref. 4392). Replaced by Thalassoma virens in the Revillagigedo Islands (Ref. 37816).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, Madagascar and Mascarenes east to Hawaiian Islands, Marquesas Islands and Easter Island, north to southern Japan and Ogasawara Islands, south to New Caledonia, Lord Howe Island and Kermadec Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth

Depth Range (m): 0 (S) - 20 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 8; Dorsal soft rays (total): 12 - 14; Analspines: 3; Analsoft rays: 10 - 12
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length max (cm): 46.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 460 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

46.0 cm TL (male/unsexed; (Ref. 30573)); max. published weight: 1,210 g (Ref. 40637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Found almost exclusively in the surge zone of outer reef flats, reef margins, and rocky coastlines, down to a depth of about 10 m (Ref. 5213). Feeds on small invertebrates (crabs, sea urchins, brittlestars) and small fishes.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

T. purpureum and T. trilobatum have nearly identical initial phases (Ref. 1602). They differ slightly in details of the head markings, and T. purpureum has a slightly longer head, shorter pectoral fins, and attains a larger size (Ref. 1602, 48636). Females best distinguished by the 'V' mark on the snout (Ref. 48636). Initial phase with a vertical dark red line below front of eye usually with a branch to front of snout (Ref 9823).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is found around coral reefs between 0-10 m depth (Sommer et al. 2006), in clean coastal waters to outer reef flats, often in the surge zone but also down to 15 m (Kuiter 2002).

Thalassoma purpureum and T. trilobatum (which have a similar geographic range, (Kuiter 2002)) have nearly identical initial (female) phases (Myers 1991), and only differ slightly in coloration and length of the head. Thalassoma purpureum has a slightly longer head and the female of this species is best distinguished by a V-shaped mark on the snout (Myers 1991, Kuiter and Tonozuka 2001). The initial phase has a vertical dark red line below the front of the eye, usually with a branch to the front of the snout (Westneat 2001). It is a protogynous hermaphrodite (DeMartini et al. 2005), and forms spawning groups (Squire and Samoilys unpub. in Claydon 2004).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 0 - 10 m (Ref. 30573)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 73 specimens in 1 taxon.
Water temperature and chemistry ranges based on 66 samples.

Environmental ranges
  Depth range (m): 0.15 - 100
  Temperature range (°C): 23.208 - 29.336
  Nitrate (umol/L): 0.045 - 2.714
  Salinity (PPS): 34.134 - 36.148
  Oxygen (ml/l): 4.454 - 4.940
  Phosphate (umol/l): 0.092 - 0.507
  Silicate (umol/l): 1.043 - 4.752

Graphical representation

Depth range (m): 0.15 - 100

Temperature range (°C): 23.208 - 29.336

Nitrate (umol/L): 0.045 - 2.714

Salinity (PPS): 34.134 - 36.148

Oxygen (ml/l): 4.454 - 4.940

Phosphate (umol/l): 0.092 - 0.507

Silicate (umol/l): 1.043 - 4.752
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 10m.
Recorded at 10 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Near Bottom, Bottom, Bottom + water column

Habitat: Reef (rock &/or coral), Reef only, Rocks, Corals, Reef associated (reef + edges-water column & soft bottom)

FishBase Habitat: Reef Associated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: mobile benthic worms, mobile benthic crustacea (shrimps/crabs), mobile benthic gastropods/bivalves, sea-stars/cucumbers/urchins, bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Pelagic spawner.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Thalassoma purpureum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 22 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACTCTCTACCTTGTATTCGGCGCATGAGCTGGGATAGTAGGGACAGCCCTAAGCCTGCTCATTCGGGCAGAATTGAGCCAGCCCGGCGCCCTCCTTGGAGACGACCAGATTTATAACGTCATCGTCACAGCCCATGCATTTGTCATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGATTCGGGAACTGACTAATTCCCCTAATGATTGGGGCCCCCGATATGGCCTTCCCTCGTATAAACAACATGAGCTTTTGGCTTCTTCCCCCTTCATTCCTCCTCCTTCTCGCTTCTTCTGGCGTTGAAGCAGGGGCCGGAACTGGATGAACAGTTTACCCGCCGCTAGCAGGTAACCTTGCCCACGCTGGCGCATCCGTTGACCTCACTATCTTCTCCTTACATCTAGCGGGCATTTCATCAATTTTAGGTGCAATTAACTTTATTACAACCATTATCAACATAAAACCCCCAGCCGTCTCTCAATATCAGACGCCTCTTTTCGTGTGAGCCGTTCTGATCACAGCAGTCCTTCTTCTACTCTCTCTTCCAGTGCTTGCTGCCGGCATTACAATGCTCCTGACGGACCGAAACCTAAACACTACCTTCTTTGACCCTGCTGGAGGAGGGGACCCCATTCTTTATCAACATCTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Thalassoma purpureum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Specimens with Barcodes: 42
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Cabanban, A. & Pollard, D.

Reviewer/s
Craig, M.T. & Carpenter, K.E.

Contributor/s

Justification
This species is widespread on coral reefs in the Indian and Pacific Oceans and is considered common in many parts of its range. There are no major threats known to this species. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is common throughout its range, and can be locally abundant. It is uncommon in Banda Flores, Indonesia, where it was found at only three of the seven sites surveyed (Mous 2002).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats known for this species, although it is occasionally collected for the aquarium trade.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for this species. However, its distribution overlaps several marine protected areas within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; gamefish: yes; aquarium: commercial; price category: very high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Thalassoma purpureum

The surge wrasse, Thalassoma purpureum, is a species of wrasse native to the southeast Atlantic Ocean through the Indian and Pacific Oceans, where it inhabits reefs and rocky coastlines in areas of heavy wave action at depths from the surface to 10 m (33 ft). It can grow to 46 cm (18 in) in total length and 1.2 kg (2.6 lb) in weight. This species is of minor importance to local commercial fisheries, is popular as a game fish, and can be found in the aquarium trade.[2]

References[edit]

  1. ^ Cabanban, A. & Pollard, D. 2010. Thalassoma purpureum. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 17 November 2013.
  2. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Thalassoma purpureum" in FishBase. October 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!