Articles on this page are available in 2 other languages: Spanish (1), Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Occurs in clear outer lagoon and seaward reefs, over open sand and rubble as well as dense coral growth. Common is shallow exposed areas (Ref. 9710). Benthopelagic (Ref. 58302). Feeds mainly on shelled benthic invertebrates (crabs, shrimps, gastropods, bivalves, brittle stars, sea urchins), also on polychaete worms and fish eggs.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is widespread in the Indo-Pacific, found from Eastern Africa in the west to Ducie Island (Pitcairn Islands group) in the east, and from the Ryukyu Islands in southern Japan (Senou et al. 2007) and the Hawaiian Islands in the north, to far northern New Zealand, including the Kermadec Islands and Rapa Island in the south.

It is replaced by Thalassoma grammaticum in the tropical eastern Pacific (Myers 1999). This species is also recorded in Pohnpei (G. Allen unpublished survey).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-Pacific: Sri Lanka to Ducie Island, north to southern Japan and the Hawaiian Islands, south to southeastern Australia, Lord Howe Island, the Kermadec Islands, and Rapa. Replaced by Thalassoma grammaticum in the tropical eastern Pacific (Ref. 37816).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific: East Africa east to Hawaiian Islands and Easter Island, north to southern Japan, south to Rottnest Island (Western Australia), New South Wales (Australia), Lord Howe Island, Norfolk Islands, New Caledonia, Kermadec Islands, Tonga and Ra
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 8; Dorsal soft rays (total): 13 - 14; Analspines: 3; Analsoft rays: 11
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 300 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

30.0 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Body without longitudinal stripes. Initial phase body yellow with light vertical red lines. Terminal phase body abruptly blue to blue-green behind pink and green head. Reddish vertical lines on body. Pectoral fins yellow on basal half, blue to black distally (Ref 9823).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species inhabits clear coastal waters to outer reef slopes and drop-offs in Australia (Kuiter 2002), over sand and rubble. It is found in depths from one to 30 m (Myers 1991, Baensch and Debelius 1997).

It forms spawning groups at 4-6 m depth, along channels or passages and promontories or bommies. It spawns from March to May and in October-November at full moon and on an ebb tide in the Marshall Islands (Colin and Bell 1991). Juvenile and adult male colour patterns differ (Kuiter 2002).

Larval duration in Hawaii was 78 days (Victor 1986).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range 1 - 30 m (Ref. 1602), usually 1 - 30 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 86 specimens in 1 taxon.
Water temperature and chemistry ranges based on 66 samples.

Environmental ranges
  Depth range (m): 0.305 - 42.7
  Temperature range (°C): 22.496 - 29.336
  Nitrate (umol/L): 0.047 - 0.498
  Salinity (PPS): 34.114 - 35.893
  Oxygen (ml/l): 4.454 - 5.079
  Phosphate (umol/l): 0.088 - 0.429
  Silicate (umol/l): 0.910 - 4.989

Graphical representation

Depth range (m): 0.305 - 42.7

Temperature range (°C): 22.496 - 29.336

Nitrate (umol/L): 0.047 - 0.498

Salinity (PPS): 34.114 - 35.893

Oxygen (ml/l): 4.454 - 5.079

Phosphate (umol/l): 0.088 - 0.429

Silicate (umol/l): 0.910 - 4.989
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 1 - 30m.
From 1 to 30 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Pelagic spawner.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Thalassoma lutescens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 56
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Thalassoma lutescens

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CATAAAGATATTGGCACCCTCTATCTTGTATTCGGCGCATGAGCCGGGATAGTAGGGACAGCCCTAAGCCTGCTCATTCGAGCAGAATTAAGCCAGCCCGGCGCCCTCCTTGGGGAC---GATCAGATCTATAACGTCATCGTTACAGCCCATGCATTTGTCATAATTTTCTTTATAGTAATACCAATTATGATCGGAGGCTTCGGAAACTGACTTATTCCCCTAATGATTGGGGCCCCTGACATGGCCTTCCCTCGTATGAACAATATAAGCTTTTGACTTCTTCCCCCCTCATTCCTGCTTCTTCTTGCCTCTTCTGGTGTTGAGGCGGGGGCCGGAACCGGATGGACAGTCTACCCGCCCTTAGCAGGTAACCTTGCCCACGCTGGTGCATCCGTTGACCTAACTATCTTCTCACTACATCTGGCAGGTATTTCATCAATTCTAGGTGCAATTAATTTCATTACAACCATTATTAATATGAAACCCCCAGCCATCTCTCAATACCAAACACCCCTTTTCGTATGGGCCGTTCTAATTACAGCAGTCCTTCTCCTCCTTTCCCTTCCAGTACTTGCTGCCGGCATTACAATGCTCCTCACAGACCGAAACCTAAACACTACCTTCTTCGACCCTGCCGGGGGAGGAGACCCAATTCTTTACCAACATCTCTTCTGATTTTTTGGTCAC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at National Institute of Water and Atmospheric Research, Wellington
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Cabanban, A. & Pollard, D.

Reviewer/s
Craig, M.T. & Carpenter, K.E.

Contributor/s

Justification
This species is widespread and common in many parts of its range, and is also found in numerous marine protected areas within its range. As it is exploited in the marine aquarium fish trade, it is important to monitor the exploitation levels of the species. This species is assessed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is considered common in many parts of its range. For example, it is very abundant in the South Pacific, it is common in Indonesia, but is relatively uncommon to rare in Malaysia (L. Rocha, S. Suharti, Y. Yusuf pers. comm.). It is rare in Banda Flores, Indonesia, where it was found at only three of the 19 sites surveyed in 2002 (A. Cabanban pers. comm.).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are no major threats known for this species, although it is collected for the aquarium trade.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for this species. However, its distribution overlaps several marine protected areas within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: very high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Thalassoma lutescens

The yellow-brown wrasse, Thalassoma lutescens, is a species of wrasse native to the Indian and Pacific Oceans, where they are found from Sri Lanka to the Hawaiian Islands and from southern Japan to Australia. An inhabitant of coral reefs, it occurs in schools at depths from 1 to 30 m (3.3 to 98 ft). It can reach 30 cm (12 in) in total length. This species is of minor importance to local commercial fisheries and can also be found in the aquarium trade.[2]

References[edit]

  1. ^ Cabanban, A. & Pollard, D. 2010. Thalassoma lutescens. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 17 November 2013.
  2. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Thalassoma lutescens" in FishBase. October 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!