Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Occurs in exposed crests of seaward and lagoon reefs, usually rock-based. Minimum depth reported from Ref. 27115.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is found in the Indo-West Pacific from the Maldives east to Fiji, and north to southern Japan, and south to the Solomon Islands and to Shark Bay in northwestern Australia. It is also reported from Pohnpei (G. Allen unpublished survey).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: Maldives to Fiji, north to southern Japan, south to Lord Howe Island.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 8; Dorsal soft rays (total): 13; Analspines: 3; Analsoft rays: 11
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 200 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

20.0 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Color pattern remains similar throughout life. Large juveniles and females are mostly black with a single white band and white area below the head to the anus. Males retain the white central band but is more yellow, and develops a second narrow band halfway towards the head (Ref. 48636). Initial phase white with 3 black bars, the first on upper half of head and anterior body containing a yellow streak at edge of opercle, the second across dorsal fin and ventrally to anus, the third covering most of body and posterior portions of dorsal and anal fins. Terminal male with yellow between black bars. Pectoral fins bluish (Ref 9823).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species occurs in coral reefs and reef flats (Nguyen and Nguyen 2006) from 1-15 m (Myers 1991) but is usually found in depths from 1-12 m (Baesch and Debelius 1997). Prey items include zoobenthos and macrofauna (Sano et al. 1984).

Color pattern remains generally similar throughout life. Large juveniles and females are mostly black with a single white band and white area below the head to the anus. Males retain the white central band, though this is more yellow, and they also develop a second narrow band halfway towards the head (Kuiter and Tonozuka 1994).

Initial phase is white with three black bars, the first on upper half of head and anterior body containing a yellow streak at edge of opercle, the second across dorsal fin and ventrally to anus, the third covering most of the body and posterior portions of dorsal and anal fins. Terminal male with yellow between black bars. Pectoral fins bluish (Westneat 2001).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; non-migratory; marine; depth range 1 - 15 m (Ref. 1602), usually 1 - 12 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 32 specimens in 1 taxon.
Water temperature and chemistry ranges based on 24 samples.

Environmental ranges
  Depth range (m): 1 - 52
  Temperature range (°C): 25.335 - 29.264
  Nitrate (umol/L): 0.019 - 1.251
  Salinity (PPS): 34.113 - 35.376
  Oxygen (ml/l): 4.438 - 4.806
  Phosphate (umol/l): 0.111 - 0.284
  Silicate (umol/l): 0.897 - 4.892

Graphical representation

Depth range (m): 1 - 52

Temperature range (°C): 25.335 - 29.264

Nitrate (umol/L): 0.019 - 1.251

Salinity (PPS): 34.113 - 35.376

Oxygen (ml/l): 4.438 - 4.806

Phosphate (umol/l): 0.111 - 0.284

Silicate (umol/l): 0.897 - 4.892
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 15m.
From 1 to 15 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Thalassoma jansenii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 16
Specimens with Barcodes: 29
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Thalassoma jansenii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CATAAAGATATTGGCACCCTCTATCTTGTGTTCGGCGCATGAGCCGGGATAGTGGGTACAGCCCTGAGCCTGCTCATTCGAGCTGAGCTAAGCCAGCCCGGCGCCCTCCTTGGAGAC---GATCAGATCTATAACGTCATCGTTACAGCCCATGCATTTGTCATAATTTTCTTTATAGTAATACCAATTATGATCGGAGGCTTCGGAAACTGACTTATTCCCCTAATGATTGGGGCCCCTGACATGGCCTTCCCTCGTATGAACAACATAAGCTTTTGACTTCTTCCCCCATCATTCCTCCTACTTCTTGCCTCTTCCGGTGTTGAAGCGGGGGCCGGAACCGGGTGAACTGTCTACCCGCCCTTGGCAGGTAACCTCGCCCACGCTGGTGCATCCGTCGACCTTACTATTTTTTCCCTACACCTGGCGGGTATCTCATCAATCCTAGGTGCAATTAACTTCATTACGACCATCATCAATATGAAACCCCCAGCCATCTCCCAATATCAGACGCCTCTTTTCGTATGAGCCGTCCTGATTACAGCAGTCCTCCTTCTCCTCTCTCTCCCTGTTCTAGCTGCTGGTATTACAATGCTCCTAACGGACCGAAATCTAAACACCACCTTCTTTGACCCTGCCGGAGGGGGGGACCCAATTCTTTACCAACACCTATTCTGATTTTTTGGTCAC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Cabanban, A. & Pollard, D.

Reviewer/s
Craig, M.T. & Carpenter, K.E.

Contributor/s

Justification
This species is widely distributed, common in many parts of its range, and is found in several marine protected areas within its range of distribution. There are no major threats known to this species. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is common in many parts of its range. For example, it is common in Indonesia (S. Suharto), and is considered moderately common in shallow waters (0-15 m) exposed to surge, in Solomon islands (Allen et al. 2006).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats known for this species, although it is collected for the aquarium trade.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for this species. However, its distribution overlaps several marine protected areas within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Thalassoma jansenii

Jansen's wrasse, Thalassoma jansenii, is a species of wrasse native to the Indian Ocean and the western Pacific Ocean. It is a reef inhabitant, preferring rocky areas, and can be found at depths from 1 to 15 m (3.3 to 49 ft). This species can grow to 20 cm (7.9 in) in total length.[1] Like many other coral reef wrasses, this species swims actively over the reef using solely their pectoral fins for thrust (known as labriform locomotion).[2] It can also be found in the aquarium trade.[1]

References[edit]

  1. ^ a b Froese, Rainer and Pauly, Daniel, eds. (2013). "Thalassoma jansenii" in FishBase. October 2013 version.
  2. ^ Fulton CJ, Bellwood DR, Wainwright PC (2001) The relationship between swimming ability and habitat use in wrasses (Labridae). Marine Biology 139, 25-33.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!