Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Occurs in aggregations over shallow lagoon and seaward reefs (Ref. 9710) and on reef flats (Ref. 9823). Feeds mainly on crustacean zooplankton (Ref. 1602). Rarely marketed.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is found from Somalia (Sommer et al. 1996) to South Africa in the west (Randall 1986) to the Line, Marquesas, and Tuamoto islands in the east, northwards to southern Japan (Senou et al. 2007), southwards to Papua New Guinea (Jenkins 2002), to the Rowley Shoals and Lord Howe Island, Australia, northern New Zealand and Rapa Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-Pacific: Somalia (Ref. 30573) and South Africa (Ref. 4392) to the Line, Marquesan, and Tuamoto islands, north to southern Japan, south to Rowley Shoals, northern New Zealand and Lord Howe and Rapa islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific: Transkei (South Africa) East Africa, Seychelles, Madagascar and Mascarenes east to Line Islands, Marquesas Islands and Tuamotu Archipelago, north to southern Japan and Ogasawara Islands, south to Lord Howe Island, New Caledonia, norther
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 8; Dorsal soft rays (total): 13; Analspines: 3; Analsoft rays: 10 - 11
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 160 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

16.0 cm SL (male/unsexed; (Ref. 9823))
  • Westneat, M.W. 2001 Labridae. Wrasses, hogfishes, razorfishes, corises, tuskfishes. p. 3381-3467. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9823)   http://www.fishbase.org/references/FBRefSummary.php?id=9823&speccode=4844 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Occurs in aggregations over shallow reefs and on reef flats (Ref. 9823). Feeds mainly on crustacean zooplankton (Ref. 1602). Rarely marketed.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Juveniles easily identified by the color pattern and rounded snout. Males become brightly colored and head usually green with a yellow band following on the body (Ref. 48636). Head naked, no scales dorsally on opercle. Initial phase with a broad blackish stripe from snout through eye to caudal-fin base (Ref 9823).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paratype for Thalassoma marnae
Catalog Number: USNM 115565
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Schultz
Year Collected: 1939
Locality: Enderbury Island, reef, Enderbury Island, Kiribati, Phoenix Islands, Pacific
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Thalassoma marnae
Catalog Number: USNM 115566
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Schultz
Year Collected: 1939
Locality: Hull Island, channel., Hull Island, Kiribati, Phoenix Islands, Pacific
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Thalassoma marnae
Catalog Number: USNM 115567
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Schultz
Year Collected: 1939
Locality: Swains Island, reef., Swains Island, American Samoa, Tokelau Islands, Pacific
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Thalassoma marnae
Catalog Number: USNM 115569
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Schultz
Year Collected: 1939
Locality: Hull Island, channel., Hull Island, Kiribati, Phoenix Islands, Pacific
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Thalassoma marnae
Catalog Number: USNM 115570
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Schultz
Year Collected: 1939
Locality: Hull Island, reef., Hull Island, Kiribati, Phoenix Islands, Pacific
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Holotype for Thalassoma marnae
Catalog Number: USNM 115563
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): L. Schultz
Year Collected: 1939
Locality: Hull Island, reef., Hull Island, Kiribati, Phoenix Islands, Pacific
  • Holotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Thalassoma marnae
Catalog Number: USNM 115564
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Schultz
Year Collected: 1939
Locality: Canton Island, ocean side reef, lagoon, channel, Canton Island, Kiribati, Phoenix Islands, Pacific
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Thalassoma marnae
Catalog Number: USNM 115568
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Schultz
Year Collected: 1939
Locality: Canton Island, reef of the widest shallow channel, Canton Island, Kiribati, Phoenix Islands, Pacific
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is found over shallow lagoon and seaward reefs at depths between 1-15 m (Lieske and Myers 1994, Myers 1991) and over reef flats (Westneat 2001). Prey items are mainly crustacean zooplankton (Myers 1991). Feeding habits include selective plankton-feeding (Sano et al. 1984) and the species was observed to be a diurnal carnivore in the Glorieusis Islands, western Indian Ocean (Durville et al. 2003).

Juveniles, females and young males have similar colour patterns, but those of larger males are different and often variable (Kuiter 2002). Small juveniles are sometimes found under ledges together with sea urchins, and they tend to form schools at an early age, often staying close to the reef substrate. Adults are often found in large schools of mixed sexes, feeding in midwater on zooplankton. Colourful males are often found separately from these schools (Kuiter 2002).

Larvae collected in Palau had a larval duration mean of 72.4 days with a range of 53-90 (Victor 1986).

This species has been observed to be a group spawner (Nakazono 1979), at depths of 5-7 m, in channels or passages and around promontory or bommie areas of coral reefs (Collin 7 Bell 1991). School size was 2.8 individuals/school with average fish lengths of 8.57 cm. Density was .0029 individual/m2 and biomass .0269 g/m2 (Matoto et al. 1996).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range 1 - 15 m (Ref. 1602), usually 1 - 15 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 130 specimens in 1 taxon.
Water temperature and chemistry ranges based on 94 samples.

Environmental ranges
  Depth range (m): 0.5 - 61
  Temperature range (°C): 24.782 - 29.214
  Nitrate (umol/L): 0.016 - 1.204
  Salinity (PPS): 33.950 - 35.381
  Oxygen (ml/l): 4.338 - 4.812
  Phosphate (umol/l): 0.055 - 0.351
  Silicate (umol/l): 0.777 - 6.035

Graphical representation

Depth range (m): 0.5 - 61

Temperature range (°C): 24.782 - 29.214

Nitrate (umol/L): 0.016 - 1.204

Salinity (PPS): 33.950 - 35.381

Oxygen (ml/l): 4.338 - 4.812

Phosphate (umol/l): 0.055 - 0.351

Silicate (umol/l): 0.777 - 6.035
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 1 - 15m.
From 1 to 15 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Thalassoma amblycephalum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTCTACCTTGTGTTCGGCGCATGAGCCGGAATGGTAGGGACAGCCCTAAGCCTGCTCATTCGGGCAGAATTAAGCCAGCCCGGCGCCCTCCTTGGAGACGACCAGATTTATAACGTCATCGTCACAGCCCATGCATTTGTCATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGCTTCGGAAACTGACTAATTCCCCTAATGATTGGGGCCCCTGACATGGCCTTCCCTCGTATGAACAACATGAGCTTTTGGCTTCTTCCCCCTTCATTCCTTCTCCTTCTCGCTTCCTCTGGTGTTGAAGCAGGAGCCGGAACTGGGTGAACAGTTTATCCGCCCCTAGCAGGTAACCTTGCCCACGCTGGCGCATCCGTTGATCTCACTATCTTCTCTTTGCATCTAGCGGGTATTTCATCAATTTTAGGTGCAATCAACTTCATTACAACCATTGTTAATATGAAACCCCCTGCTATCTCTCAGTACCAGACACCCCTTTTCGTATGAGCCGTTCTAATTACAGCAGTCCTTCTTCTACTCTCTCTTCCAGTGCTTGCTGCCGGCATTACAATGCTCCTAACAGACCGAAATCTAAATACCACCTTCTTTGACCCTGCCGGAGGAGGAGACCCAATTCTTTATCAACATCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Thalassoma amblycephalum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 31
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Cabanban, A. & Pollard, D.

Reviewer/s
Craig, M.T. & Carpenter, K.E.

Contributor/s

Justification
This species is widespread in the Indo-Pacific, and is considered common in many parts of its range. It is collected for the aquarium trade, but there are no major threats known to this species. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is considered common in many parts of its range, such as in the Philippines and in Indonesia.

In the Great Barrier Reef, 93 +/-75 individuals were found in 104 sites at inter-reef and deep locations (Cappo et al. 2007). This species is common in the Solomon Islands at depths of 0-15 m (Allen 2006) and in the Banda Islands, Indonesia where it was found in 15 out of 19 sites surveyed (Mous 2002). The maximum number found using Baited Remote Underwater Video was two individuals in the green zone of the Magnetic Shoals (site 14) of the Great Barrier Reef Marine Park, Australia (Speare and Stowar 2007).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are no major threats known for this species, although it is occasionally collected for the aquarium trade. This species may be subject to localized threats from habitat destruction in some parts of Indonesia, Malaysia and the Philippines (Burke et al. 2004, Hodgson 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for this species. However, its distribution overlaps several marine protected areas within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Thalassoma amblycephalum

Thalassoma amblycephalum, the blunt-headed wrasse, is a species of wrasse native to the Indian Ocean and the western Pacific Ocean. It is a reef inhabitant, being found in schools at depths from 1 to 15 m (3.3 to 49 ft). This species can reach 16 cm (6.3 in) in standard length. It can also be found in the aquarium trade.[2]

References[edit]

  1. ^ Cabanban, A. & Pollard, D. 2010. Thalassoma amblycephalum. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 17 November 2013.
  2. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Thalassoma amblycephalum" in FishBase. October 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!