Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Found mostly on coral reefs and reef flats to at least 20 m depth. Feed mainly on small crustaceans, mollusks and echinoderms (Ref. 9823). Juveniles secretive on inshore reefs. Large adults swim openly on reefs, singly or in small loose aggregations (Ref. 48636).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is endemic to the Red Sea. Records from the Gulf of Aden and Socotra Island need to be verified.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species occurs in the Indo-Pacific from Oman and East Africa to South Africa, eastward to the Pitcairn group, northward to southern Japan and southward to southern western Australia in the west and southern Queensland including Lord Howe Island and Middleton Reef in the Tasman Sea. Records from Socotra Island and Yemen need to be checked to see if they are H. sexfasciatus or fasciatus.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-Pacific: Red Sea (Ref. 1602) south to Inhaca Island, Mozambique (Ref. 4392) and east to Tahiti.
  • Westneat, M.W. 2001 Labridae. Wrasses, hogfishes, razorfishes, corises, tuskfishes. p. 3381-3467. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9823)   http://www.fishbase.org/references/FBRefSummary.php?id=9823&speccode=4844 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, South Africa, Seychelles, Madagascar and Mascarenes east to Wake Atoll and Pitcairn Group, north to southern Japan, south to Western Australia, New South Wales (Australia), Lord Howe Island and Rapa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 10 - 11; Analspines: 3; Analsoft rays: 11
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 800 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

80.0 cm TL (male/unsexed; (Ref. 559))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Found mostly on coral reefs and reef flats at depths of 1 to at least 20 m. Feeds mainly on small crustaceans, molluscs and echinoderms (Ref. 9823).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lips thick with age (Ref. 1623). Several color phases with age and sex (Ref. 48636). Basic color pattern changes little with growth although the posteriormost white bands disappear on large individuals (Ref. 1602).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species inhabits areas of coral reefs, sand rubble and sheltered areas (Lieske and Myers 1994). This species is found at depths between 1-20 m (Lieske and Myers 1994).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species is a small wrasse (up to 30 cm) characteristic of shallow sandy and rubble bottoms around coral reef areas with a depth range from 1-35 m. It feeds mainly on small crustaceans, molluscs and echinoderms (Westneat 2001). Juveniles are secretive on inshore reefs. Large adults swim openly on reefs, singly or in small loose aggregations (Kuiter and Tonozuka 2001). There are no demographic data available. Spawning occurs in small groups in reef passes (Colin and Bell 1991).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range 1 - 20 m (Ref. 30573)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 33 specimens in 1 taxon.
Water temperature and chemistry ranges based on 23 samples.

Environmental ranges
  Depth range (m): 1 - 38
  Temperature range (°C): 25.198 - 29.336
  Nitrate (umol/L): 0.050 - 0.732
  Salinity (PPS): 32.279 - 35.381
  Oxygen (ml/l): 4.448 - 4.746
  Phosphate (umol/l): 0.055 - 0.327
  Silicate (umol/l): 0.869 - 4.892

Graphical representation

Depth range (m): 1 - 38

Temperature range (°C): 25.198 - 29.336

Nitrate (umol/L): 0.050 - 0.732

Salinity (PPS): 32.279 - 35.381

Oxygen (ml/l): 4.448 - 4.746

Phosphate (umol/l): 0.055 - 0.327

Silicate (umol/l): 0.869 - 4.892
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 1 - 20m.
From 1 to 20 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Hemigymnus fasciatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 23
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hemigymnus fasciatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 18 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTCTATTTAGTATTCGGCGCCTGAGCTGGGATGGTAGGCACAGCCCTAAGCCTACTTATTCGGGCTGAACTAAGCCAACCCGGCGCTCTCCTCGGGGATGATCAGATTTACAATGTAATCGTTACGGCCCATGCATTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGCTTTGGGAACTGACTGATCCCTTTAATGATCGGAGCCCCCGACATAGCTTTCCCCCGAATAAACAACATGAGCTTCTGACTTCTACCCCCCTCCTTCCTACTCCTTCTTGCATCCTCTGGTGTCGAAGCAGGCGCCGGGACTGGCTGAACAGTCTACCCGCCCCTAGCAGGAAACCTGGCCCACGCCGGGGCATCCGTTGATTTGACTATTTTCTCCCTGCATCTGGCCGGAATTTCGTCCATCCTCGGCGCTATTAACTTCATTACAACCATCATCAACATGAAACCTCCTGCCATTTCCCAATACCAGACACCTCTTTTCGTTTGAGCTGTTCTAATCACGGCTGTACTTCTCCTTCTCTCCCTACCCGTCCTTGCCGCTGGTATTACGATGCTCCTAACAGACCGAAATCTAAATACTACTTTCTTTGACCCTGCTGGTGGGGGAGACCCAATTTTATATCAACACTTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 3 specimens with morphological vouchers housed at Florida Museum of Natural History
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Choat, J.H., Myers, R. & Pollard, D.

Reviewer/s
Liu, M. & Carpenter, K.E.

Contributor/s

Justification
There is very little information about this species and it is only known from two records. There have been issues with misidentification and distributional limits. There are no known threats. It is listed as Data Deficient.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Choat, J.H., Pollard, D. & Myers, R.

Reviewer/s
Sadovy, Y. & Carpenter, K.E.

Contributor/s

Justification
This species is a small abundant wrasse with wide Indo-Pacific distribution. There are no major threats, although it is captured in subsistence fisheries in a few locations. This species is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There is no population information for this species.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There is no population information available for this species.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are no major threats known for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
There are no major threats known for this species, although it is collected for the aquarium trade and in artisanal fisheries. It is one of a large number of small widely distributed wrasses taken occasionally.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no specific conservation measures in place for this species. Its distribution overlaps several marine protected areas within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Actions

Conservation Actions
There are no specific conservation measures in place for this species. Its distribution overlaps several marine protected areas within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: very high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Barred thicklip

The barred thicklip, Hemigymnus fasciatus, is a species of wrasse native to the Indian Ocean and the western Pacific Ocean from the Red Sea and the African coast to Mozambique eastward to Tahiti. This species inhabits coral reefs at depths from 1 to 25 m (3.3 to 82.0 ft). This species can reach 80 cm (31 in) in total length. It is of minor importance to local commercial fisheries and can be found in the aquarium trade.[2]

References[edit]

  1. ^ Choat, J.H., Pollard, D. & Myers, R. 2010. Hemigymnus fasciatus. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 09 November 2013.
  2. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Hemigymnus fasciatus" in FishBase. August 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!