Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Inhabits shallow reefs and rocky shores, usually in weedy areas exposed to surge (Ref. 9710, 48636). Feeds on benthic crustaceans, mollusks, polychaetes, forams, fishes, and fish eggs (Ref. 1602). One of several similar species that have near identical juvenile and female stages (Ref. 48636).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is widespread in the Indo-Pacific, from Cocos-Keeling Islands in the eastern Indian Ocean to the Line and Tuamoto islands, north to southern Japan, south to New South Wales and Lord Howe Island.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: Cocos Island in the eastern Indian Ocean to the Line and Tuamoto islands, north to southern Japan, south to New South Wales and Lord Howe Island. Replaced by Halichoeres nebulosus in the western Indian Ocean.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Indian Ocean, western Pacific: Cocos-Keeling Islands and northwestern Australia east to Wake Atoll and Pitcairn Group, north to southern Japan, south to New South Wales (Australia), New Caledonia, Lord Howe, Norfolk and Kermadec Islands, Tonga and
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 11; Analspines: 3; Analsoft rays: 11
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 125 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

12.5 cm SL (male/unsexed; (Ref. 9823))
  • Westneat, M.W. 2001 Labridae. Wrasses, hogfishes, razorfishes, corises, tuskfishes. p. 3381-3467. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9823)   http://www.fishbase.org/references/FBRefSummary.php?id=9823&speccode=4844 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Females olivaceous on back, the scale edges dark brown, pale ventrally, with whitish blotches of unequal size and a large pink area posteriorly on the abdomen; a black spot on opercular flap, small one behind eye, one at front of dorsal fin and a large one rimmed in yellow or blue in middle of fin; no black spot at upper base of pectoral fins; males green with orange-red spots, some linked to form irregular markings, the white blotches and large pink area on abdomen lost, and the black spots lost or reduced. Males are distinguished by different cheek patterns. In this species, it has a near horizontal pink band below the eye (Ref. 48636).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Halichoeres daedalma
Catalog Number: USNM 51845
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): D. Jordan & V. Kellogg
Year Collected: 1902
Locality: Samoa, Apia., Upolu, Samoa, Samoa Islands, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Halichoeres daedalma
Catalog Number: USNM 126607
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): D. Jordan & V. Kellogg
Year Collected: 1902
Locality: Samoa, Apia., Upolu, Samoa, Samoa Islands, Pacific
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is reef associated from 1-15 m. It inhabits shallow reefs and rocky shores, and is commonly found in seagrass areas exposed to surge and rubble. It feeds on benthic crustaceans, mollusks, polychaetes, forams, fishes, and fish eggs (Myers 1991). It is one of several similar species that have near identical juvenile and female stages (Kuiter and Tonozuka 2001).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 0 - 5 m (Ref. 30874)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 75 specimens in 1 taxon.
Water temperature and chemistry ranges based on 61 samples.

Environmental ranges
  Depth range (m): 0.4575 - 54
  Temperature range (°C): 22.496 - 29.336
  Nitrate (umol/L): 0.016 - 0.834
  Salinity (PPS): 32.886 - 35.552
  Oxygen (ml/l): 4.290 - 5.079
  Phosphate (umol/l): 0.079 - 0.284
  Silicate (umol/l): 0.910 - 4.892

Graphical representation

Depth range (m): 0.4575 - 54

Temperature range (°C): 22.496 - 29.336

Nitrate (umol/L): 0.016 - 0.834

Salinity (PPS): 32.886 - 35.552

Oxygen (ml/l): 4.290 - 5.079

Phosphate (umol/l): 0.079 - 0.284

Silicate (umol/l): 0.910 - 4.892
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 5m.
Recorded at 5 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits shallow reefs and rocky shores, usually in weedy areas exposed to surge. Feeds on benthic crustaceans, molluscs, polychaetes, forams, fishes, and fish eggs.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Halichoeres margaritaceus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTCTATCTTGTGTTCGGCGCATGAGCCGGAATAGTGGGTACAGCCCTGAGCCTGCTTATTCGAGCAGAGCTAAGCCAGCCCGGCGCCCTCCTTGGGGACGATCAGATCTATAACGTCATCGTCACAGCCCATGCATTTGTCATAATTTTCTTTATAGTAATACCAATTATGATCGGAGGATTCGGAAACTGACTTATTCCCCTAATGATTGGGGCCCCTGACATGGCCTTCCCTCGAATGAACAACATAAGCTTTTGACTCCTTCCCCCATCATTCCTTCTTCTCCTTGCCTCTTCTGGCGTTGAAGCAGGGGCCGGAACCGGATGGACAGTTTACCCCCCTTTAGCAGGTAACCTCGCCCACGCTGGCGCATCCGTTGACCTTACTATTTTTTCATTACACCTAGCAGGTATCTCATCAATCCTGGGTGCAATTAACTTCATTACAACCATTATTAATATGAAGCCCCCAGCCATCTCACAATACCAGACACCTCTCTTCGTGTGGGCCGTCCTAATTACAGCAGTCCTTCTTCTCCTCTCCCTTCCGGTTCTGGCTGCTGGAATTACTATGCTCCTAACGGACCGAAATCTAAACACCACCTTCTTTGACCCCGCTGGAGGGGGGGACCCAATCCTTTACCAGCATCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Halichoeres margaritaceus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 37
Specimens with Barcodes: 42
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at British Antarctic Survey
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Rocha, L. & Craig, M.

Reviewer/s
Sadovy, Y. & Carpenter, K.E.

Contributor/s

Justification
This species is widespread in the Indo-Pacific and is common. There are no major threats known to this species. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
There is no population information available for this species. However, it is very common throughout its range.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats known to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no specific conservation measures in place for this species. Its distribution overlaps several marine protected areas within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!