Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Inhabit seagrass beds and algal-covered flats, occasionally in lagoon and seaward reefs to a depth of at least 30 m (Ref. 1602, 41878, 48636). Benthopelagic (Ref. 58302). Usually solitary. Juveniles secretive in seagrasses or attached Sargassum; adults usually in small loose aggregations, but occasionally form large schools to spawn (Ref. 48636). Feed mainly on crustaceans, mollusks, sea urchins (Ref. 37816) and other hard-shelled prey. Oviparous, distinct pairing during breeding (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is found from the Red Sea and East Africa to the Hawaiian and Easter Islands, north to southern Japan, south to Lord Howe Island.

In Australia, it is known from the central Western Australian coast, around the tropical north of the country, and south to the central coast of New South Wales (Froese and Pauly 2008).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: Red Sea and East Africa to the Hawaiian and Easter islands, north to southern Japan, south to Lord Howe Island.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, South Africa, Madagascar and Mascarenes east to Hawaiian Islands and Easter Island, north to southern Japan, south to Western Australia, New South Wales (Australia), New Caledonia, Lord Howe Island, and Rapa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 12 - 14; Analspines: 3; Analsoft rays: 11 - 12
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 500 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

50.0 cm SL (male/unsexed; (Ref. 9823))
  • Westneat, M.W. 2001 Labridae. Wrasses, hogfishes, razorfishes, corises, tuskfishes. p. 3381-3467. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9823)   http://www.fishbase.org/references/FBRefSummary.php?id=9823&speccode=4844 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Inhabits seagrass beds and algal-covered flats, occasionally in lagoon and seaward reefs to a depth of at least 30 m (Ref. 1602). Mostly solitary in habit . Feeds mainly on crustaceans and other hard-shelled prey.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Young individuals are usually a mottled brown or green, sometimes with a broad lateral stripe (Ref. 1602). Rare individuals may be uniformly yellow (Ref. 1602). Large males may develop a bright yellow, orange, black, white, or multicolored patch on their sides behind their pectoral fins (Ref. 1602).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species inhabits seagrass beds and algal-covered flats, occasionally in lagoon and seaward reefs to a depth of at least 30 m (Myers 1991, Kuiter and Tonozuka 2001, Gell and Whittington 2002), and is only occasionally found in reefs (Myers 1991). It is a benthopelagic species and usually solitary. Juveniles are secretive in seagrasses or attached Sargassum (Kuiter and Tonozuka 2001), adults usually occurs in small loose aggregations, but occasionally form large schools to spawn. It feeds mainly on crustaceans, mollusks, sea urchins (Myers 1999) and other hard-shelled prey (Froese and Pauly 2008).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 1 - 30 m (Ref. 1602), usually 2 - 30 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 46 specimens in 1 taxon.
Water temperature and chemistry ranges based on 27 samples.

Environmental ranges
  Depth range (m): 0.305 - 150
  Temperature range (°C): 25.282 - 29.003
  Nitrate (umol/L): 0.050 - 0.612
  Salinity (PPS): 32.886 - 35.368
  Oxygen (ml/l): 4.290 - 4.753
  Phosphate (umol/l): 0.086 - 0.284
  Silicate (umol/l): 1.103 - 4.892

Graphical representation

Depth range (m): 0.305 - 150

Temperature range (°C): 25.282 - 29.003

Nitrate (umol/L): 0.050 - 0.612

Salinity (PPS): 32.886 - 35.368

Oxygen (ml/l): 4.290 - 4.753

Phosphate (umol/l): 0.086 - 0.284

Silicate (umol/l): 1.103 - 4.892
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 30m.
From 1 to 30 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occur inshore (Ref. 75154). Inhabit seagrass beds and algal-covered flats, occasionally in lagoon and seaward reefs to a depth of at least 30 m (Ref. 1602, 41878, 48636). Usually solitary. Juveniles secretive in seagrasses or attached Sargassum; adults usually in small loose aggregations, but occasionally form large schools to spawn (Ref. 48636). Feed mainly on crustaceans, mollusks, sea urchins (Ref. 37816) and other hard-shelled prey.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Lecithophyllum Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Cheilio inermis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 40
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cheilio inermis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 14 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTCTATCTGGTATTTGGTGCCTGAGCCGGAATGGTGGGCACGGCCCTAAGTCTACTTATTCGAGCCGAACTAAGCCAGCCTGGCGCCCTTCTTGGAGACGATCAAATCTATAATGTAATTGTCACGGCACACGCATTCGTAATGATTTTCTTTATAGTAATGCCAATTATGATTGGGGGGTTTGGAAACTGGCTTATCCCCCTAATGATTGGGGCCCCTGACATGGCTTTCCCCCGAATGAATAACATAAGCTTTTGGCTCCTACCCCCCTCTTTCCTTCTTCTTCTCGCTTCTTCTGCCGTTGAAGCAGGGGCAGGAACAGGCTGGACTGTTTACCCCCCGCTAGCAGGTAATCTCGCCCATGCAGGGGCCTCCGTTGACCTCACAATCTTTTCACTGCATTTAGCAGGAATTTCATCAATTTTAGGGGCAATCAACTTTATTACAACCATCGTTAACATGAAACCTCCCGCCATCTCACAATACCAAACCCCCCTGTTTGTGTGAGCCGTCCTAATCACAGCAGTTCTGCTTCTTCTCTCCCTGCCTGTCCTTGCTGCCGGAATCACCATGCTCCTCACAGACCGGAACCTTAATACAACTTTCTTTGATCCCGCTGGAGGGGGAGACCCCATCCTGTACCAACACTTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Cheung, W.W.L., Sadovy, Y. & Liu, M.

Reviewer/s
Craig, M.T. & Carpenter, K.E.

Contributor/s

Justification
This species is widespread and is common in many parts of its range. There are no major threats to this species. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
There is no population information available for this species. It is common througout its range, especially in algal covered flats and seagrass beds.

In French Polynesia, a total of five individual were recorded in various UVC surveys, with a size of 32-35cm (M. Kulbicki pers. comm. 2008). In Fiji, a total of 148 individuals were recorded in various UVC surveys, with a size of 10-40cm (M. Kulbicki pers. comm. 2008). In New Caledonia, a total of 673 individuals were recorded in various UVC surveys, with a size of 3-40 cm (M. Kulbicki pers. comm. 2008). In Tonga, a total of 92 individuals were recorded in various UVC surveys, with a size of 5-50 cm (M. Kulbicki pers. comm. 2008). In New Caledonia, 13 individuals were caught in four stations with combined total weight of 255 g (M. Kulbicki pers. comm. 2008).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats known for this species. It is caught in multi-species fisheries, and occasionally collected for the aquarium trade. Current evidence however suggests that the scale of its fisheries is generally small (e.g., Boer et al. 2001, Williams et al. 2008).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures for this species. However, this species distribution includes a number of Marine Protected Areas within its range. More species-specific information on harvest and trade for is needed for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: very high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Cheilio inermis

The cigar wrasse, Cheilio inermis, is a species of wrasse native to the Indo-Pacific. It is mainly found on tropical reefs at depths to 30 m (98 ft) in the Indo-Pacific region, Red Sea included.[2] They inhabit seagrass beds and algae-covered flats, occasionally in lagoon and seaward reefs to a depth of at least 30 m. They are a mostly solitary species. Their diet includes crustaceans, mollusks, sea urchins, and other hard-shelled prey.[3]

Description[edit]

It grows to an average length of 35 cm (14 in) but can reach up to 50 cm (20 in).[4]

Young individuals are usually a mottled brown or green, sometimes with a broad lateral stripe. Rare individuals may be uniformly yellow. Large males may develop a bright yellow, orange, black, white, or multicolored patch on their sides behind their pectoral fins.[5]

Due to their adult size and diet, they are rarely kept in the aquarium.

Synonyms[edit]

These described species have all been determined to be junior synonyms of this species:[6]

References[edit]

  1. ^ Cheung, W.W.L., Sadovy, Y. & Liu, M. 2010. Cheilio inermis. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 11 September 2013.
  2. ^ http://eol.org/pages/994403/details#distribution
  3. ^ http://eol.org/pages/994403/details#comprehensive_description
  4. ^ http://www.fishbase.org/summary/5623
  5. ^ http://eol.org/pages/994403/details#diagnostic_description
  6. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Cheilio inermis" in FishBase. August 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!