Overview

Comprehensive Description

Biology

A little-known deepwater dogfish found on the upper continental slopes to at least 450 m (Ref. 31367). Ovoviviparous (Ref. 50449). Probably taken in bottom trawls (Ref. 31367). Caught by demersal longline fisheries operating in deepwater areas. Utilised for its meat, fins (low value) and liver oil (very high value) (Ref.58048).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-West Pacific: Gulf of Aden, Japan, Taiwan, and northern Papua New Guinea. Often confused with Centrophorus granulosus.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Western and eastern Indian Ocean: Somalia (Gulf of Aden), India and Sri Lanka (possibly southwest coast of India and probably Gulf of Mannar between India and Sri Lanka) (Compagno in prep.).

Northwest and western central Pacific: Japan (Northeastern Honshu, Shikoku, and Okinawa), Taiwan, northern Papua-New Guinea and Indonesia (Compagno in prep, W. White pers. obs. 2007).

Taxonomic revision of Centrophorus is currently underway and may reveal that more than one species is involved across the distributional range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 2; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 870 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

87.0 cm TL (male/unsexed; (Ref. 31367))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Adults with tips of dorsal fins black, prominently marked from base of fins (Ref. 31367).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

bathydemersal; marine; depth range 183 - 450 m (Ref. 31367)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
A poorly known bathydemersal deepwater species found from depths of 150 to 450 m on the outer continental and insular shelves and upper slopes. Size data are available from Indonesia, based on 93 specimens. Maximum size for females was 78 cm total length (TL), and 60.3 cm TL for males (W. White pers. obs. 2007). Males mature at 55?58 cm TL. The smallest pregnant female was 73.5 cm TL (females probably mature at a smaller size) (W. White pers. obs. 2007). Size at birth is 36?42 cm TL (W. White pers. obs. 2007). Reproduction is ovoviviparous. Other size and biological information available for C. atromarginatus may refer to other species.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 183 - 450m.
From 183 to 450 meters.

Habitat: bathydemersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Ovoviviparous, embryos feed solely on yolk (Ref. 50449). Distinct pairing with embrace (Ref. 205). Gives birth to a single pup. Born at 28-36 cm TL (Ref.58048).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Centrophorus atromarginatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATATTTAATTTTTGGTGCATGAGCAGGAATAGTGGGCACAGCTCTTAGCTTACTTATTCGTACAGAATTAAGCCAACCGGGAACACTTCTGGGGGATGATCAAATCTACAATGTTATTGTGACTGCTCACGCTTTTGTAATAATCTTTTTTATAGTCATGCCTGTAATAATTGGTGGATTCGGAAATTGATTAGTGCCTTTAATAATTGGTGCACCAGATATAGCTTTTCCACGAATAAATAATATGAGCTTTTGACTACTGCCTCCGTCTCTCTTATTACTTTTAGCCTCCGCTGGTGTTGAAGCAGGAGCTGGAACCGGCTGAACAGTTTACCCCCCTCTTGCTGGTAATATAGCCCATGCTGGAGCATCCGTAGATTTAGCCATCTTCTCACTTCATTTAGCCGGTATTTCTTCAATTTTAGCCTCTATTAATTTTATTACTACTATCATTAATATAAAACCCCCTGCCATTTCTCAATATCAAACGCCACTTTTTGTTTGATCCATCCTTGTAACCACCGTCCTTCTCCTACTTGCTCTTCCTGTCCTTGCCGCTGCAATTACAATACTGTTAACCGACCGTAATCTAAATACAACATTTTTTGATCCCGCTGGAGGGGGGGACCCCATTCTTTACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Centrophorus atromarginatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
McCormack, C.,& White, W.

Reviewer/s
Valenti, S.V., Graham, K. & Fowler, S.L. (Shark Red List Authority)

Contributor/s

Justification
The Dwarf Gulper Shark (Centrophorus atromarginatus) is a poorly known medium size (to at least 94 cm total length) deepwater shark found at depths of 150?450 m off Japan, Taiwan, Indonesia and northern Papua New Guinea in the Western Pacific, off Somalia, in the Gulf of Aden, and possibly off India and Sri Lanka in the western Indian Ocean. This species is targeted using gillnets (and possibly other gears) in localized fisheries in Surga Bay, Honshu, Japan for the production of squalene liver oil. Landings of sharks in Japan are reported collectively and there are no species specific estimates of the quantity taken. The Dwarf Gulper Shark is also taken by deepwater bottom trawlers off Taiwan where all parts of the catch are utilised. There is no information available on the interaction of this species with fisheries off Somalia and India. Given the inherent biological vulnerability of this genus and the rapid population declines observed in other exploited Centrophorus species, the threat status of the Dwarf Gulper Shark is of concern. However, the total lack of catch information means that the species cannot be assessed beyond Data Deficient at present.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Unknown.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Data deficient (DD)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
The Dwarf Gulper Shark is targeted by localized fisheries in Japan for its liver oil (Compagno in prep, H. Ishihara, pers. comm. 2006, S. Tanaka pers. comm. 2007). This fishery targets deep water species of shark using gillnets and possibly other gear in Suruga Bay, Honshu. Catch of sharks and rays are cited from the Annual Statistics of Japan fisheries, Statistical Information Center of the Japan Fisheries Agency. However, the statistics are not species-specific but rather reported as ?general sharks and general rays? (H. Ishihara pers. comm. 2006).

This species is also caught in bottom trawls off Taiwan. No part of the catch is discarded in Taiwan (B. Séret pers. comm. 2006) and individuals are probably also used in the production of fishmeal.

No information is available on the interaction of this species with fisheries throughout its range in the Indian Ocean. Industrial deepwater fishing for lobsters is reported off Somalia, perhaps down to 400 m, but the gear type is not reported and no data are available from the fishery. In the mid-1970s, deep-sea trawling was carried out by SOMALFISH, a Somali/USSR joint venture commercial fishing company off Somalia and since then several foreign fishing companies have been given fishing licenses to fish in the offshore EEZ of Somalia (FAO 2007a).

There are also an estimated 700 foreign-owned vessels that are fully engaged in unlicensed fishing in Somali waters (FAO 2007a). This illegal, unregulated, and unreported (IUU) fishing occurs offshore, as well as in the inshore (FAO 2007a). This makes it impossible to monitor total fishery production and the state of the fishery resources they are exploiting (FAO 2007a). There is also strong suspicion of illegal dumping of industrial and nuclear wastes along the Somali coast (FAO 2007a).

Little is known about deepwater fisheries operating off India at present. There were apparently 100 deep-sea fishing vessels in operation off India during 2004 (FAO 2007b). Marine fish production from near shore waters off India has reached almost a plateau and it is likely that fisheries will develop to exploit deeper waters off shore pelagic species further (FAO 2007b).

The threatened status of this species is uncertain, but of concern because of local deepwater fisheries, little knowledge of its biology, and its restricted distribution (Compagno in prep). Given the biological vulnerability of this genus and the rapid population declines observed in other exploited Centrophorus species (for example Centrophorus harrissoni), any bycatch is of concern. There is a need to collect species-specific catch data throughout this species? range, to assess the impact of fisheries on this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No management or conservation efforts are currently in place. Like many deeper water species more information on biology, ecology and importance in fisheries are required to further assess status and any future conservation needs. Where taken, catches require monitoring, particularly as deepwater fisheries expand worldwide. The development and implementation of management plans (national and/or regional e.g., under the FAO International Plan of Action for the Conservation and Management of Sharks: IPOA-Sharks) are required to facilitate the conservation and management of all chondrichthyan species in the region.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Dwarf gulper shark

The dwarf gulper shark, Centrophorus atromarginatus, is a dogfish of the family Centrophoridae found in the Indo-West Pacific oceans, from the Gulf of Aden, Japan, Taiwan, and northern Papua New Guinea.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!