Overview

Comprehensive Description

Biology

Found on edge of rocky areas, muddy bottom and areas of high sediment load; jetty piles and moorings; often associated with sponges or sea squirts or attached to man-made objects; moves to deeper waters in winter. Ovoviviparous (Ref. 205). The male carries the eggs in a brood pouch which is found under the tail (Ref. 205). This species manifested evidence of genetically monogamous character in seahorses (Ref. 59213). Site fidelity is observed during breeding season (Ref. 59213). Length type refers to height (= TL - head length) (Ref. 30915).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

H. subelongatus is known from Freemantle, Perth, Swan River, and Houtman Abrolhos Islands in Western Australia (Lourie et al. 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Indian Ocean: southwest Australia. International trade is monitored through a licensing system (CITES II, since 5.15.04) and a minimum size of 10 cm applies.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Australia: Western Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 1620
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 200 mm OT
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

20.0 cm OT (male/unsexed; (Ref. 30915))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description: (based on 23 specimens): Adult height: 13.0-20.0cm. Rings: 11+34 (33-36). Snout length: 2.1 (1.9-2.3) in head length. Dorsal fin rays: 18 (16-20) covering 2+1 rings. Pectoral fin rays: 17 (16-18). Coronet: high to very high, with an expanded rounded top (larger and more fluted in females, smaller and more rounded in males). Spines: low, rounded bumps onlyOther distinctive characters: very thick rings; narrow body; usually double rounded cheek spines; long snout (about 1/2 head length); prominent rounded eye spine.Color pattern: usually pale with net-like pattern of reticulating brown lines over body and tail; may be yellow, orange, black, purple, white, cream or pink; brown ring around spines; striped snout; dark vertical line edging either side of dorsal surface of trunk.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The species is found on the edge of rocky areas, muddy bottoms, and areas of high sediment load; jetty piles and mooring; and it is often associated with sponges or sea squirts or attached to man-made objects. They have been reported to occur at depths of 1 to 25 m and to move to deeper waters in winter (Lourie et al. 1999).

This species may be particularly susceptible to decline. All seahorse species have vital parental care and many species studied to date have high site fidelity (Perante et al. 2002, Vincent et al. in review), highly structured social behaviour (Vincent and Sadler 1995), and relatively sparse distributions (Lourie et al. 1999). The importance of life history parameters in determining response to exploitation has been demonstrated for a number of species (Jennings et al. 1998).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; non-migratory; brackish; marine; depth range 1 - 25 m (Ref. 30915)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 25m.
From 1 to 25 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found in inshore waters (Ref. 75154). Also found in rocks and gravel and among sponges (Ref. 52034).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Gestation period 2-3 weeks, depending on water temperature. This species manifested evidence of genetically monogamous character in seahorses (Ref. 59213). Site fidelity is observed during breeding season (Ref. 59213). Male carries the eggs in a brood pouch (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hippocampus subelongatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTATACTTAGTATTTGGTGCTTGAGCCGGAATAGTCGGCACCGCACTCAGCCTATTAATTCGAGCAGAACTAAGTCAGCCAGGAGCTTTACTAGGGGATGATCAAATCTATAATGTTATCGTAACTGCCCATGCTTTCGTAATAATTTTTTTTATGGTAATACCAATTATGATTGGGGGTTTTGGTAATTGATTAATTCCTTTAATAATTGGAGCGCCTGATATAGCCTTCCCTCGGATAAACAATATGAGTTTTTGATTATTACCACCTTCTTTCCTCCTTCTCCTTGCCTCATCAGGAGTAGAAGCCGGTGCAGGAACAGGTTGAACTGTTTACCCCCCATTAGCAGGCAACCTAGCACATGCTGGAGCTTCAGTGGACTTAACAATTTTCTCCCTCCATTTAGCAGGTGTTTCGTCAATCCTCGGAGCTATTAACTTTATTACTACTATTATTAATATAAAACCCCCGTCAATCTCACAATATCAAACACCACTGTTTGTATGAGCAGTTTTAGTAACTGCAGTTCTACTCTTACTATCCCTACCTGTATTAGCAGCTGGTATTACTATGCTTTTAACGGATCGGAATTTAAATACAACATTCTTTGACCCTTCTGGAGGAGGAGATCCTATCCTTTATCAACATTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hippocampus subelongatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2002
  • Needs updating

Assessor/s
Project Seahorse

Reviewer/s
Lafrance, P., Lourie, S., Marsden, D. & Vincent, A.C.J. (Syngnathid Red List Authority)

Contributor/s

Justification
H. subelongatus is collected for the aquarium trade, but the effects of this collection on the persistence of the population is debated. Glenn Moore (cited in Lourie et al. 1999) reported that numbers recently declined substantially in the Swan River near Perth due to over-collecting for aquaria. However, Kuiter (2000) believes that the number of specimens collected for the aquarium trade is "minuscule compared to the wild population" and that fluctuation in the Swan River is due to seasonal conditions and not to collecting.

Recent research on H. subelongatus focuses mainly on reproductive behaviour (Jones et al. 1998, Kvarnemo et al. 2000) and aquaculture (Payne and Rippingale 2000). Appropriate data on distribution and abundance in the wild, and on fishing mortality, are not yet available. Further research is needed in order to evaluate the status of the species.

In addition to exploitation for the aquarium trade, habitat degeneration is a potential threat to the species.

History
  • 1996
    Vulnerable
  • 1996
    Vulnerable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Data are not currently available on wild populations.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
H. subelongatus is collected for the aquarium trade, but the effects of this collection on the persistence of populations is debated. In addition to exploitation for the aquarium trade, habitat degeneration is a potential threat to the species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Data deficient (DD)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species was moved under the Australian Wildlife Protection Act in 1998. Further research on this species is needed. It is listed on CITES Appendix II.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Tiger snout seahorse

The tiger snout seahorse or West Australian seahorse (Hippocampus subelongatus) is a species of fish in the Syngnathidae family. It is endemic to Australia. Its natural habitats are open seas and shallow seas.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!