Overview

Comprehensive Description

Biology

In Zostera seagrass beds; also in estuaries. Length type refers to height (= TL - head length). Ovoviviparous (Ref. 205). The male carries the eggs in a brood pouch which is found under the tail (Ref. 205).
  • Lourie, S.A., A.C.J. Vincent and H.J. Hall 1999 Seahorses: an identification guide to the world's species and their conservation. Project Seahorse, London. 214 p. (Ref. 30915)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Confirmed distribution: Japan, Suspected distribution: Cambodia, China, Thailand, Viet Nam (Lourie et al. 2004).

Follow the link below for map of the known range of H. mohnikei.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Pacific: Japan and Viet Nam; occurrence along Chinese coast needs confirmation. Status: International trade is monitored through a licensing system (CITES II, since 5.15.04).
  • Lourie, S.A., A.C.J. Vincent and H.J. Hall 1999 Seahorses: an identification guide to the world's species and their conservation. Project Seahorse, London. 214 p. (Ref. 30915)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western North Pacific: South China Sea to southern Japan.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 1516
  • Lourie, S.A., A.C.J. Vincent and H.J. Hall 1999 Seahorses: an identification guide to the world's species and their conservation. Project Seahorse, London. 214 p. (Ref. 30915)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 80 mm OT
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

8.0 cm OT (male/unsexed; (Ref. 30915))
  • Lourie, S.A., A.C.J. Vincent and H.J. Hall 1999 Seahorses: an identification guide to the world's species and their conservation. Project Seahorse, London. 214 p. (Ref. 30915)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description: (based on 14 specimens): Adult height: 5.0-8.0cm. Rings: 11+38 (37-40). Snout length: 3.0 (2.8-3.9) in head length. Dorsal fin rays: 15-16 covering 2+1 rings. Pectoral fin rays: 13 (12-14). Coronet: low, ridge-like crest. Spines: low, body appears very laterally flattened. Other distinctive characters: double rounded cheek spines and below eye; tail extremely long in proportion to body; slight enlargement of trunk rings numbered (1), 4 and 7 and tail rings numbered 5, 10 (or 9) and 14.Color pattern: usually dark brown all over, but may be mottled.
  • Lourie, S.A., A.C.J. Vincent and H.J. Hall 1999 Seahorses: an identification guide to the world's species and their conservation. Project Seahorse, London. 214 p. (Ref. 30915)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
No research has focused on the in situ ecology of adult H. mohnikei. One study has examined planktonic juveniles of the species that range in size from 6.0–65.3 mm (standard length (SL) as measured from the tip of the tail to the dorsal margin of the opercular opening and from this point to the tip of the snout) (Kanou and Kohno 2001). These juveniles were found in plankton tows from May–January. Young from 15–34 mm SL showed high gut fullness and had consumed small prey including Oithona davisae and Penilia avirostris. In contrast, large planktonic individuals ≥35 mm showed low gut fullness, preying on larger but less abundant prey items such as species of Brachyura.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; non-migratory; marine; depth range 1 - ? m (Ref. 30915)
  • Lourie, S.A., A.C.J. Vincent and H.J. Hall 1999 Seahorses: an identification guide to the world's species and their conservation. Project Seahorse, London. 214 p. (Ref. 30915)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

In Zostera seagrass beds; also in estuaries (Ref. 30915). Also in Ref. 9137.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Male carries the eggs in a brood pouch (Ref. 205).
  • Breder, C.M. and D.E. Rosen 1966 Modes of reproduction in fishes. T.F.H. Publications, Neptune City, New Jersey. 941 p. (Ref. 205)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hippocampus mohnikei

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACTTAGTATTTGGTGCTTGAGCCGGAATAGTCGGCACTGCACTCAGCCTCTTAATTCGAGCAGAACTAAGTCAACCAGGAGCTTTACTAGGTGATGATCAGATCTATAATGTTATCGTAACTGCTCATGCTTTCGTAATAATTTTCTTTATAGTGATACCAATTATAATTGGAGGATTTGGTAATTGACTAATTCCTTTAATAATTGGAGCCCCTGATATAGCATTTCCTCGAATAAATAACATAAGTTTCTGATTATTACCGCCCTCATTCCTTCTTCTCCTCGCCTCATCAGGCGTAGAAGCTGGTGCAGGGACAGGTTGAACTGTTTATCCCCCTCTAGCAGGCAATCTAGCTCATGCTGGAGCTTCTGTAGACCTGACAATTTTCTCTCTTCATCTAGCGGGTGTTTCATCAATCCTAGGGGCTATTAACTTTATTACTACTATCATTAACATAAAACCCCCGTCAATCACGCAATACCAAACACCCTTATTTGTGTGAGCTGTTTTAGTAACCGCAGTATTACTTTTACTATCTCTACCTGTATTAGCAGCTGGTATTACCATACTCCTTACAGATCGAAACTTAAACACAACATTTTTTGATCCTTCTGGAGGAGGCGACCCTATTCTTTACCAACACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hippocampus mohnikei

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2006

Assessor/s
Morgan, S.K.

Reviewer/s
Morgan, S.K. & Foster, S.J. (Syngnathid Red List Authority)

Contributor/s

Justification
For this species, a large portion of its putative range has not been confirmed. There is no information on densities from these areas or natural/anthropogenic activities that may impact natural populations. Therefore, it is not possible to assess trends in species numbers. However, its known habitats, a) Zostera seagrass beds in inlet water (Masuda et al. 1984), and b) estuaries (Viet Nam) (Lourie et al. 1999), are both coastal zones subject to intense fishing, boating and habitation pressure in areas of Asia such as Cambodia, China, Thailand and Viet Nam where the species is thought to occur. Common sense suggests that threats are likely to exist and that populations may be under pressure. There is no evidence for a dried trade in this species at present.

History
  • 1996
    Vulnerable
  • 1996
    Vulnerable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Unknown.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Unknown.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Data deficient (DD)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The entire genus Hipppocampus is listed on Appendix II of the CITES (Convention on International Trade in Endangered Species of Wild Fauna and Flora), effective May 2004. H. mohnikei is listed (as H. japonicus) as Vulnerable in the 1994 Viet Nam Red Data Book (Lourie et al. 2004).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Japanese seahorse

The Japanese seahorse (in Japanese, kitano-umi-uma and sangotatsu) or lemur-tail seahorse (Hippocampus mohnikei) is a species of fish in the Syngnathidae family. The Japanese seahorse reaches a maximum length of 8.0 cm, is usually dark brown and has a relatively long tail, a ridgelike coronet and flattened spines. Many seahorse species look similar, so in addition to any distinguishing features, individual specimens are identified using a series of specific measurements and counts of anatomical features such as spines and tail rings.

H. mohnikei has a planktonic stage in the first six months of life, after which they settle, preferably in Zostera sea grass beds or estuaries, and begin to breed. They are ovoviviparous and the males carry the eggs in a brood pouch. While several seahorse species are used in traditional Chinese medicine, H. mohnikei is not one of them.

Distribution and feeding[edit]

The mid-range of Q and maybe P and U. mohnikei distribution is around 28 N latitude.[1] For many years the only confirmed distribution was around Japan. However, it was recently observed as far south as the Palk Bay coast of southeastern India.[2] It has also recently been positively observed in Kampot, Cambodia.[3] It is also suspected to be in the waters around China, Thailand and Viet Nam.

They have a planktonic stage during the first six months of life, when they are between the lengths of 15.1-45.5 mm, in which they drift with other plankton in the water column.[4] As they grow their food preferences shift from smaller items such as Oithona davisae and Penilia avirostris to larger food species.[5] After the planktonic stage, they prefer to settle in Zostera sea grass beds and estuaries.[6]

Identification[edit]

H. mohnikei reaches a maximum length of 8.0 cm and is usually dark brown all over, but may be mottled. The coronet of H. mohnikei has a low, ridge-like crest. Its spines are low and the body appears laterally flattened. It has double rounded cheek spines and double rounded spines below the eye. Its tail is long in proportion to its body. There is a slight enlargement of the 4th, 7th and sometimes the first trunk rings, as well as a slight enlargement of the 5th, 10th, 14th and sometimes 9th tail rings.[7]

Many seahorse species look similar. If it is not immediately identifiable, specific measurements and counts are used to narrow the possibilities.[8] Following is a table of measurements for H. mohnikei. (If there is a range, it is given in parentheses.)[9]

CharacteristicMeasurement
Maximum height of the specimen8.0 cm
Length of the snout in relation to the length of the head (HL/SnL)3.0 (2.8 – 3.9)
Number of tail rings38 (37-40)
Number of trunk rings11
Number of cheek spines2 rounded
Number of eye spines2 rounded
Number of trunk and tail rings that support the dorsal finTrunk 2, Tail 1
Number of dorsal fin rays15-16
Number of pectoral fin rays13 (12-14)

Similar species to H. mohnikei include H. coronatus (which has a high coronet and greatly expanded spines bordering a short dorsal fin) and H. sindonis (which has fewer tail rings, 10 trunk rings and a more prominent coronet).

Growth and development[edit]

H. mohnikei have completely developed dorsal, anal, and pectoral fins even as juveniles of 6.0 mm long. Juveniles 6.0-26.4 mm total length also have a tiny caudal fin with just two rays.[10] H. mohnikei reaches maturity at 55 mm and can reach a length of 80 mm. They start breeding in the season after birth, at six months to one year.[11] H. mohnikei is ovoviviparous. The male carries the eggs in a brood pouch, which is found under the tail.[12]

References[edit]

  1. ^ Foster SJ, Vincent CJ. Life History and ecology of seahorses: implications for conservation and management. Journal of Fish Biology 65(1):1-61, 2004.
  2. ^ M. Thangaraj A. P. Lipton. Occurrence of the Japanese seahorse Hippocampus mohnikei Bleeker 1854 from the Palk Bay coast of south-eastern India. Journal of Fish Biology 70(1): 310-312, 2007
  3. ^ http://www.marineconservationcambodia.org/Marine-Conservation-Cambodia-News/Marine-Research-News-Cambodia/Hippocampus-Mohnikei-first-recorded-sighting-in-Cambodia.html?ref=nf
  4. ^ Foster SJ, Vincent CJ. Life History and ecology of seahorses: implications for conservation and management. Journal of Fish Biology 65(1):1-61, 2004.
  5. ^ Kouki K and Hiroshi K. Early life history of a seahorse, Hippocampus mohnikei, in Tokyo Bay. Icthyological Research 48(4):361-368, 2001
  6. ^ FishBase.org page on H. mohnikei
  7. ^ Lourie SA, Foster SJ, Cooper EWT, Vincent ACJ. A Guide to the Identification of Seahorses. Project Seahorse and TRAFFIC North America. Washington, D.C.: University of British Columbia and World Wildlife Fund, 2004. ISBN 0-89164-169-6 pp. 75-76
  8. ^ Lourie SA, Foster SJ, Cooper EWT, Vincent ACJ. A Guide to the Identification of Seahorses. Project Seahorse and TRAFFIC North America. Washington, D.C.: University of British Columbia and World Wildlife Fund, 2004. ISBN 0-89164-169-6 p. 12
  9. ^ Lourie SA, Foster SJ, Cooper EWT, Vincent ACJ. A Guide to the Identification of Seahorses. Project Seahorse and TRAFFIC North America. Washington, D.C.: University of British Columbia and World Wildlife Fund, 2004. ISBN 0-89164-169-6 pp. 18-24
  10. ^ Kouki K and Hiroshi K. Early life history of a seahorse, Hippocampus mohnikei, in Tokyo Bay. Icthyological Research 48(4):361-368,2001
  11. ^ Foster SJ, Vincent CJ. Life History and ecology of seahorses: implications for conservation and management. Journal of Fish Biology 65(1):1-61, 2004.
  12. ^ FishBase.org page on H. mohnikei
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!