Overview

Comprehensive Description

Biology

Deep water species, associated with corals (Ref. 52034). Ovoviviparous (Ref. 205). The male carries the eggs in a brood pouch which is found under the tail (Ref. 205).
  • Lourie, S.A., A.C.J. Vincent and H.J. Hall 1999 Seahorses: an identification guide to the world's species and their conservation. Project Seahorse, London. 214 p. (Ref. 30915)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Hippocampus kelloggi has a relatively wide range throughout much of the Indo-Pacific. It has been recorded from Zanzibar in Tanzania, Pakistan, India, and southeast Asia, and north to China and Japan as well as Australia. This species has a suspected distribution including the east coast of Africa (North of Zanzibar), the Red Sea, the Persian Gulf and the Gulf of Oman (Lourie et al. 2004).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: East Africa and the Red Sea to Japan and Lord Howe Island, Australia. International trade is monitored through a licensing system (CITES II, since 5.15.04) and a minimum size of 10 cm applies.
  • Lourie, S.A., A.C.J. Vincent and H.J. Hall 1999 Seahorses: an identification guide to the world's species and their conservation. Project Seahorse, London. 214 p. (Ref. 30915)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, northwestern Indian Ocean: Arabian Sea.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Pacific: Philippines to southern Japan.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 1719
  • Lourie, S.A., A.C.J. Vincent and H.J. Hall 1999 Seahorses: an identification guide to the world's species and their conservation. Project Seahorse, London. 214 p. (Ref. 30915)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 250 mm OT
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

28.0 cm OT (male/unsexed; (Ref. 45091))
  • Kuiter, R.H. 2000 Seahorses, pipefishes and their relatives: a comprehensive guide to Syngnathiformes. TMC Publishing, Chorleywood, England. (Ref. 45091)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description: (based on 22 specimens): Adult height: 15.0-25.0cm. Rings: 11+40 (39-41). Snout length: 2.1 (2.0-2.3) in head length. Dorsal fin rays: 18 (17-19) covering 2+1 rings. Pectoral fin rays: 18 (17-19). Coronet: high, with five short spines, and high plate in front of coronet.Spines: low and rounded, slightly better developed in younger specimens, but still blunt-tippedOther distinctive characters: long, slightly backwards pointing, rounded cheek spine; deep head; narrow body; thick body rings; prominent, rounded eye spine; thick snout.Color pattern: pale, often with tiny white spots running in vertical lines, but otherwise uniform in color.Young H. kelloggi look very similar to H. spinosissimus.
  • Lourie, S.A., A.C.J. Vincent and H.J. Hall 1999 Seahorses: an identification guide to the world's species and their conservation. Project Seahorse, London. 214 p. (Ref. 30915)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Hippocampus kelloggi is most commonly associated with gorgonian corals and sea whips as well as soft bottomed habitats (Lourie et al. 2004). It can be found in relatively deep waters, with a maximum recorded depth of 152m (Lourie et al. 2004, Choo and Liew 2003).

All seahorse species have vital parental care, and many species studied to date have high site fidelity (Perante et al. 2002, Foster and Vincent 2004), highly structured social behaviour (Vincent and Sadler 1995), and relatively sparse distributions (Lourie et al. 1999)- these traits make seahorses vulnerable to over-exploitation. They also have some traits, such as small body size, fast growth and high fecundity, that may confer resilience to high levels of exploitation (Morgan 2007). However, a specialised life-history coupled with a dependence on habitats that are subject to extremely high fishing pressure, and the fact that seahorses do not move very much and are thus easily captured, means they are very vulnerable to over-exploitation. The importance of life history parameters in determining response to exploitation has been demonstrated for a number of species, including seahorses (Jennings et al. 1998, Foster and Vincent 2004).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

bathydemersal; non-migratory; marine; depth range ? - 120 m (Ref. 52034)
  • Foster, S.J. and A.C.J. Vincent 2004 Life history and ecology of seahorses: implications for conservation and management. J. Fish Biol. 65:1-61. (Ref. 52034)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 3 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 84.2 - 139
  Temperature range (°C): 24.022 - 25.857
  Nitrate (umol/L): 3.610 - 7.089
  Salinity (PPS): 34.451 - 34.546
  Oxygen (ml/l): 3.436 - 4.008
  Phosphate (umol/l): 0.392 - 0.683
  Silicate (umol/l): 4.097 - 4.739

Graphical representation

Depth range (m): 84.2 - 139

Temperature range (°C): 24.022 - 25.857

Nitrate (umol/L): 3.610 - 7.089

Salinity (PPS): 34.451 - 34.546

Oxygen (ml/l): 3.436 - 4.008

Phosphate (umol/l): 0.392 - 0.683

Silicate (umol/l): 4.097 - 4.739
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Male carries the eggs in a brood pouch (Ref. 205).
  • Breder, C.M. and D.E. Rosen 1966 Modes of reproduction in fishes. T.F.H. Publications, Neptune City, New Jersey. 941 p. (Ref. 205)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hippocampus kelloggi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACTTAGTATTTGGTGCTTGGGCCGGAATAGTCGGCACTGCACTCAGCCTTTTAATCCGAGCAGAACTAAGTCAACCAGGAGCTTTATTAGGGGACGATCAAATCTATAATGTTATCGTAACTGCTCATGCTTTTGTAATAATTTTTTTTATAGTAATGCCAATTATAATCGGGGGTTTCGGTAATTGATTAGTCCCATTAATAATCGGAGCGCCTGATATAGCCTTTCCTCGAATAAATAACATAAGTTTTTGATTATTACCCCCTTCTTTTCTCCTCCTCCTTGCTTCGTCAGGAGTAGAAGCTGGGGCGGGAACAGGTTGGACTGTTTACCCCCCACTAGCAGGCAATTTGGCGCACGCTGGAGCCTCTGTAGACTTAACAATCTTCTCTCTTCATTTAGCAGGTGTTTCATCAATTCTAGGGGCTATTAACTTTATTACTACTATTATTAATATAAAACCCCCATCAATTTCACAATATCAAACACCATTATTTGTATGAGCAGTTTTAGTAACCGCAGTTCTACTTTTATTATCATTACCTGTACTAGCAGCCGGGATTACCATACTTCTCACAGACCGAAACTTAAACACAACATTTTTTGATCCTTCCGGAGGAGGGGACCCCATCCTCTATCAACACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hippocampus kelloggi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2d+4d

Version
3.1

Year Assessed
2012

Assessor/s
Wiswedel, S.

Reviewer/s
Woodall, L. & Foster, S.

Contributor/s

Justification
Hippocampus kelloggi is one of the five species most often reported as being traded internationally (Evanson et al. 2011, UNEP-WCMC 2012a). This species has been observed in trade throughout its range since the mid to late 1990's and in these areas, the primary source of seahorses for trade was bycatch (McPherson and Vincent 2004, Murugan et al. 2008, Perry et al. 2010). Surveys of fishers and traders in East Africa in 2000 and Thailand in 1998–1999 reported declines in the availability of seahorses (McPherson and Vincent 2004, Perry et al. 2010). More recent surveys of bycatch in India have also reported declines in catches of seahorses, including H. kelloggi (UNEP-WCMC 2012b).

Trade in this species is currently continuing both legally and illegally, with much of the reported trade originating in East Asia (UNEP-WCMC 2012a,b). Using large trade volumes as an indicator of high levels of exploitation, most of which can likely be attributed to non-selective fishing practices, it is suspected that populations of H. kelloggi have declined by at least 30% over at least the last 10 to 15 years and that these declines are likely to continue into the future. This species is therefore listed as Vulnerable under Criterion A.

History
  • 2002
    Data Deficient
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
As Hippocampus kelloggi is relatively wide-spread (Lourie et al. 2004) it is difficult to accurately assess the global population trend for this species. There is, however, evidence from trade research across its range of declines in the availability of seahorses due to extensive exploitation (McPherson et al. 2004, Meeuwig et al. 2006, Perry et al. 2010). Even though some countries within the range of H. kelloggi restrict or ban the trade in wild specimens, illegal trade is reported to occur (UNEP-WCMC 2012b).

Historically, surveys in 2000 in East Africa reported trade in H. kelloggi (among other species) and that fishers and traders noted that the availability and size of seahorses in the area were declining (McPherson and Vincent 2004). The fishers and traders attributed these declines to their capture in non-selective fishing gear and destructive fishing methods such as dynamite fishing (McPherson and Vincent 2004, UNEP-WCMC 2012b). In Thailand, fishers and traders reported trade in H. kelloggi in 1998 and 1999, that the majority of seahorses were landed as trawl bycatch and that the availability of seahorses was decreasing (Perry et al. 2010).

Hippocampus kelloggi is one of the five most reported species in international trade (Evanson et al. 2011, UNEP-WCMC 2012a), although it is unclear how much of the natural population, this trade represents. All Hippocampus species are listed under Appendix II of the Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES). This means that countries who are signatories to CITES are subject to regulations on the export of seahorses. H. kelloggi was selected for review of significant trade at the 24th CITES Animals Committee due to large and potentially unregulated numbers of in international trade (UNEP-WCMC 2012b). This review revealed that in China, H. kelloggi was once the most commonly caught species but currently populations are considered to be depleted and the species is listed nationally as Endangered. Also, declines in H. kelloggi were reported in India, the Philippines, United Republic of Tanzania and Vietnam (as cited in UNEP-WCMC 2012b).

Although it is difficult to estimate the rate of decline of this species, it is clear that throughout its range H. kelloggi is under severe pressure. This species has been observed in trade throughout its range since the mid to late 1990's with seahorses primarily landed as trawl bycatch (Vincent 1996, McPherson and Vincent 2004, Murugan et al. 2008, Perry et al. 2010). Legal and illegal trade in this species is ongoing (UNEP-WCMC 2012a,b). Thus, it can be suspected that populations of H. kelloggi have declined by at least 30% over at least the last 10 to 15 years and that these declines are likely to continue into the future.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Hipocampus kelloggi is threatened from bycatch in multiple artisanal as well as commercial fisheries throughout its range such as in East Africa (McPherson and Vincent 2004), India (Murugan et al. 2008) and East Asia (e.g., Meeuwig et al. 2006, Perry et al. 2010) and this is the major threat facing this species. Hippocampus kelloggi is heavily traded for traditional medicines throughout its range; it is one of the five most reported specie in trade (Evanson et al. 2011, UNEP-WCMC 2012a). The large volumes of legal and illegal trade throughout this species' range are an indicator of high levels of exploitation pressure from bycatch exerted on this species.

Seahorses life history and ecological traits may increase their susceptibility to these threats (see Habitats and Ecology).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Vulnerable (VU) (A2d+4d)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
All Hippocampus species are listed under Appendix II of the Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES). This means that countries who are signatories to CITES are subject to regulations on the export of seahorses. Countries are required to provide permits for all exports of seahorses and are meant to provide evidence that these exports are not detrimental to wild populations. However a lack of basic information on distribution, habitat and abundance means many CITES Authorities cannot assess sustainability of their seahorse exploitation and meet their obligations to the Convention. The challenge is particularly large in that most seahorses entering trade are caught incidentally as bycatch and thus imposing export quotas would achieve next to nothing for wild populations.

CITES has recommended a minimum size limit of 10 cm height for all seahorse specimens in trade (CITES Decision 12.54). This limit represents a compromise between the best biological information available at the time of listing and perceived socio-economic feasibility. But we urgently need information on wild populations to assess their conservation status and take conservation action, as well as refine management recommendations. For example, evidence on variation in the spatial and temporal abundance of seahorses would enable areas of high seahorse density to be identified, as the basis for considering area restrictions on non-selective fishing gear that obtains Hippocampus species as bycatch. An understanding of the technical and logistical feasibility of returning to the sea live seahorses taken as bycatch in various types of fishing gear would provide the basis for considering the feasibility of minimum size limits and/or other output controls. Establishing monitoring program of landings of seahorses at representative sites, taking into account different gear types and means of extraction and recording catch and effort metrics would allow us to assess population conservation status and development management recommendations for various fishery types.

H. kelloggi
is listed in the 1994 Viet Nam Red Data Book, although the accompanying image is of H. trimaculatus (Lourie et al. 2004).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Great seahorse

The great seahorse, Kellogg's seahorse, or offshore seahorse (Hippocampus kelloggi) is a species of fish in the Syngnathidae family. It is found in possibly Australia, China, India, Indonesia, Japan, Pakistan, the Philippines, Taiwan, Tanzania, and Vietnam. Its natural habitat is shallow seas.

Source[edit source | edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!