Overview

Comprehensive Description

Biology

Length type refers to Height (= from top of coronet to the tip of straightened tail). This species is mainly found in pairs (Ref. 48635) on coral reefs, sponge gardens, kelp, and floating Sargassum. Nocturnal, site faithful. Feeds on zooplankton (Ref. 85309). Ovoviviparous (Ref. 205). The male carries the eggs in a brood pouch which is found under the tail (Ref. 205). Life span probably more than 2-3 years. Used for traditional Chinese medicine (Ref. 85309).
  • Lourie, S.A., A.C.J. Vincent and H.J. Hall 1999 Seahorses: an identification guide to the world's species and their conservation. Project Seahorse, London. 214 p. (Ref. 30915)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

The primary range of H. comes is the Philippines, where they are heavily exploited by subsistence fishers. H. comes are also collected for the aquarium industry in Lampung, Sumatera, Indonesia, but were not found elsewhere in Indonesia during an intensive three-month field survey (Lourie unpubl. data). Moreover H. comes is known in the Andaman Islands only from a single photograph, and in Malaysia only from a single specimen (Lourie unpubl. data).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Central Pacific: Malaysia, Thailand, Singapore, Viet Nam, Indonesia and Philippines. Confused with Hippocampus kuda. International trade is monitored through a licensing system (CITES II, since 5.15.04) and a minimum size of 10 cm applies.
  • Lourie, S.A., A.C.J. Vincent and H.J. Hall 1999 Seahorses: an identification guide to the world's species and their conservation. Project Seahorse, London. 214 p. (Ref. 30915)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Andaman Sea to Malacca Strait.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 1719
  • Lourie, S.A., A.C.J. Vincent and H.J. Hall 1999 Seahorses: an identification guide to the world's species and their conservation. Project Seahorse, London. 214 p. (Ref. 30915)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 146 mm OT
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

18.7 cm OT (male/unsexed; (Ref. 52034))
  • Foster, S.J. and A.C.J. Vincent 2004 Life history and ecology of seahorses: implications for conservation and management. J. Fish Biol. 65:1-61. (Ref. 52034)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description: (based on 27 specimens): Adult height: 10.7-14.6cm. Rings: 11+35-36 (34-37). Snout length: 2.2 (1.9-2.5) in head length. Dorsal fin rays: 18 (17-19) covering 2+1 rings. Pectoral fin rays: 17 (16-19). Coronet: small and quite low, with five distinct rounded knobs or spinesSpines: knob-like and blunt, to well-developed and quite sharp; often with dark band around them near tip. Other distinctive characters: cheek spines double; double spines below, and sometimes also above eye; prominent, sharp nose spine; snout long and slender.Color pattern: commonly hues of yellow and black, sometimes alternating; striped tail (although this may not be visible in dark specimens); mottled or blotched pattern on body; may have fine white lines radiating from eye.
  • Lourie, S.A., A.C.J. Vincent and H.J. Hall 1999 Seahorses: an identification guide to the world's species and their conservation. Project Seahorse, London. 214 p. (Ref. 30915)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
H. comes are found on coral reefs, seagrass beds, and mangrove habitats. This species may be particularly susceptible to decline. All seahorse species have vital parental care, and many species studied to date have high site fidelity (Perante et al. 2002, Vincent et al. in review), highly structured social behaviour (Vincent and Sadler 1995), and relatively sparse distributions (Lourie et al. 1999). The importance of life history parameters in determining response to exploitation has been demonstrated for a number of species (Jennings et al. 1998).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; non-migratory; marine; depth range 15 - 30 m (Ref. 90102)
  • Allen, G.R. and M.V. Erdmann 2012 Reef fishes of the East Indies. Perth, Australia: Universitiy of Hawai'i Press, Volumes I-III. Tropical Reef Research. (Ref. 90102)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 6m.
Recorded at 6 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Also found among sponges and algal beds (Ref. 52034).
  • Foster, S.J. and A.C.J. Vincent 2004 Life history and ecology of seahorses: implications for conservation and management. J. Fish Biol. 65:1-61. (Ref. 52034)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Male carries the eggs in a brood pouch (Ref. 205). Gestation period 2-3 weeks (but varies with water temperature) (Ref. 30915).
  • Lourie, S.A., A.C.J. Vincent and H.J. Hall 1999 Seahorses: an identification guide to the world's species and their conservation. Project Seahorse, London. 214 p. (Ref. 30915)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hippocampus comes

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACTTAGTATTTGGTGCTTGAGCCGGAATAGTCGGCACTGCACTCAGCCTATTAATTCGAGCAGAACTAAGTCAGCCAGGAGCTTTACTAGGGGATGATCAAATCTATAATGTTATCGTAACTGCCCATGCTTTCGTAATAATTTTTTTTATAGTAATACCAATTATGATCGGAGGTTTTGGTAATTGATTAGTTCCTTTAATAATTGGAGCGCCTGATATAGCCTTCCCTCGGATAAACAATATGAGTTTTTGATTATTACCTCCTTCTTTCCTCCTTCTCCTTGCCTCATCAGGAGTAGAAGCCGGTGCAGGAACAGGTTGAACTGTTTACCCCCCATTAGCAGGCAACCTAGCACATGCTGGAGCTTCAGTAGACTTAACAATTTTCTCCCTCCATTTAGCAGGTGTTTCGTCAATCCTCGGAGCTATTAACTTTATTACCACTATTATTAATATAAAACCCCCATCAATTTCACAATATCAAACACCACTGTTTGTATGAGCAGTCTTAGTAACTGCAGTTCTACTCTTACTATCCCTGCCTGTATTAGCAGCTGGTATTACTATACTTTTAACAGATCGGAATTTAAATACAACATTCTTTGACCCTTCTGGAGGAGGAGATCCTATTCTCTATCAACACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hippocampus comes

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2cd

Version
3.1

Year Assessed
2002
  • Needs updating

Assessor/s
Project Seahorse

Reviewer/s
Lafrance, P., Lourie, S., Marsden, D. & Vincent, A.C.J. (Syngnathid Red List Authority)

Contributor/s

Justification
Hippocampus comes is targeted by fishers supplying a substantial trade in seahorses for medicinal and aquarium uses. This species is also incidentally caught (bycatch) in other fisheries and affected by habitat degradation. Given that H. comes is among the most commonly traded seahorse species, particularly for ornamental display, fishers' and traders' evidence of declines in seahorse availability raise concern (Vincent 1996) for this species.

Hippocampus comes has been studied in situ in the central Philippines since 1995, as part of a conservation program in an area where this species is of considerable economic importance (Vincent and Pajaro unpubl. data). The longevity of these animals is estimated as 3.2 years (Meeuwig unpubl. data), and they first mature at about one year old. Generation time therefore must be somewhere between 1 and 3.2 years. Declines under criterion A must be considered over 10 years, as this is undoubtedly longer than three generations. Fishers in Bohol, central Philippines, reported a decline in mean catch per unit effort (CPUE) from 24 seahorses per night per fisher in 1986–1990 (Vincent and Pajaro unpubl. data) to 2.9 seahorses per night per fisher in 1996–1999 (Vincent et al. in prep.). From these numbers, we can estimate an 84% decline in CPUE from 1991–2001 if we assume a linear decline between 1986 and 1999.

Other fisheries targeting H. comes occur in other areas of the Philippines, including Quezon, Iloilo (Panay), Bantayan Island (Cebu), and Surigao del Sur (Mindanao). H. comes are also caught incidentally in pushnets in shallow water, as well as occasionally in trawls from deeper water (Pajaro unpubl. data). Declines of varying severity have been reported in Quezon for H. comes specifically, and in most other areas of the Philippines and Southeast Asia for seahorses as a group (Vincent 1996, Vincent and Perry unpubl. data). Decline in and fragmentation of H. comes' coral, seagrass, and mangrove habitats throughout its range may lead to declines in populations in addition to those caused by the fisheries and trade. Damage to coral reef ecosystems by dynamite and cyanide fishing have been well documented, particularly in the Philippines. Land-based activities such as forestry often lead to increased siltation in surrounding marine waters, thereby smothering coral reefs and seagrass beds. The fishing gears used in seagrass beds often result in substantial trampling by fishers (Pajaro unpubl. data).

A precautionary listing of Vulnerable is warranted, inferring overall numeric declines of 30–50%. The more severe population declines in Bohol are unlikely to be representative of the species throughout its range. Fishing pressure in the central Philippines is particularly high and the reefs that comprise a major habitat are particularly accessible. Even in the central Philippines, H. comes in other habitats, such as seagrass meadows and deeper soft bottom habitats, are much less heavily targeted.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Hippocampus comes is targeted by fishers supplying a substantial trade in seahorses for medicinal and aquarium uses. This species is also incidentally caught (bycatch) in other fisheries and affected by habitat degradation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Vulnerable (VU) (A2cd)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Hippocampus comes has been studied in situ in the central Philippines since 1995, as part of a conservation program in an area where this species is of considerable economic importance (Vincent and Pajaro unpubl. data). It is listed on CITES Appendix II.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquarium: commercial
  • Lourie, S.A., A.C.J. Vincent and H.J. Hall 1999 Seahorses: an identification guide to the world's species and their conservation. Project Seahorse, London. 214 p. (Ref. 30915)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Tiger tail seahorse

The tiger tail seahorse (Hippocampus comes) is a species of fish in the Syngnathidae family. It is found in India, Indonesia, Malaysia, the Philippines, Singapore, Thailand and Vietnam. Its natural habitats are subtidal aquatic beds and coral reefs. It is threatened by habitat loss.

The tiger tail sea horse lives in Western Central Pacific: Malaysia, Singapore, Thailand, Vietnam, and the Philippines. It lives from 2-3 years. It is harmless. Its climate in water is tropical; 15°N - 1°N and Its maximum size is 18.7 cm. Its snout is 2.2 in head length; it is used to suck up food. They eat small fish, coral, small shrimp, and plankton. The most common pattern is alternating yellow and black. The tail has stripes from the belly to the tip of the tail. These sea horses are normally found in pairs on coral reefs, sponge gardens, kelp, or floating Sargassum. The male carries the eggs in a brood pouch on their chest which holds from 1 - 2,000 eggs and the pregnancy takes from 1 to 4 weeks. Its also used for traditional Chinese medicine. Seahorse populations are thought to have been endangered in recent years by over fishing and habitat destruction. The seahorse is used in traditional Chinese medicine, and as many as 20 million seahorses may be caught each year and sold for this purpose. Import and export of seahorses has been controlled under CITES since May 15, 2004. They don't have scales as fish do, they have more like hard thin skin stretched out around bony rings on their bodies. They swim upright, not horizontally.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!