Overview

Comprehensive Description

Biology

Length type refers to Height (= from top of coronet to the tip of straightened tail). This species is mainly found in pairs (Ref. 48635) on coral reefs, sponge gardens, kelp, and floating Sargassum. Nocturnal, site faithful. Feeds on zooplankton (Ref. 85309). Ovoviviparous (Ref. 205). The male carries the eggs in a brood pouch which is found under the tail (Ref. 205). Life span probably more than 2-3 years. Used for traditional Chinese medicine (Ref. 85309).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Hippocampus comes occurs in coastal areas of the southeast Asian countries of Cambodia, Indonesia, Malaysia, Singapore, Thailand, Vietnam, the Philippines, and the Andaman Islands.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Central Pacific: Malaysia, Thailand, Singapore, Viet Nam, Indonesia and Philippines. Confused with Hippocampus kuda. International trade is monitored through a licensing system (CITES II, since 5.15.04) and a minimum size of 10 cm applies.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Andaman Sea to Malacca Strait.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 1719
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 146 mm OT
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

18.7 cm OT (male/unsexed; (Ref. 52034))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description: (based on 27 specimens): Adult height: 10.7-14.6cm. Rings: 11+35-36 (34-37). Snout length: 2.2 (1.9-2.5) in head length. Dorsal fin rays: 18 (17-19) covering 2+1 rings. Pectoral fin rays: 17 (16-19). Coronet: small and quite low, with five distinct rounded knobs or spinesSpines: knob-like and blunt, to well-developed and quite sharp; often with dark band around them near tip. Other distinctive characters: cheek spines double; double spines below, and sometimes also above eye; prominent, sharp nose spine; snout long and slender.Color pattern: commonly hues of yellow and black, sometimes alternating; striped tail (although this may not be visible in dark specimens); mottled or blotched pattern on body; may have fine white lines radiating from eye.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology

H. comes is found on coral reefs, in seagrass beds, and in macroalgal beds in shallow waters from the low tide line to 10m with the deepest record of 20m. (Lourie et al. 2004; Morgan and Lourie 2006). This species displays ontogenetic differences in its use of habitat at the scale of reef zones with juveniles (25 -105 mm, standard length) most abundant in wild macro-algal beds (Sargassum spp.) while adults (>105 mm, standard length) occupy both coral reefs and macro-algal habitats (Morgan and Lourie 2006, Morgan and Vincent 2007, Morgan 2008 (PhD thesis)). In reefs, adults prefer to seek shelter within or under structures by day and rise up to grasp holdfasts by night (Perante et al. 2002, Morgan and Vincent 2007).

Like all seahorse species, H. comes exhibits ecological and life-history traits which may make it particularly susceptible to threats. These traits include vital parental care, high site fidelity (Perante et al. 2002), highly structured social behaviour (Vincent and Sadler 1995), and relatively sparse distributions (Lourie et al. 2004). Other similarly important traits in H. comes and other seahorses, such as small body size, fast growth rate, ontogenetic shifts in habitat preference, crepuscular habits and high fecundity may grant resilience towards exploitation pressures (Perante et al. 2002; Morgan and Vincent, 2007). However, given increasing fishing pressures, habitat degradation of many heavily fished inshore waters and some traits that convey vulnerability, the species is at risk of overexploitation. The importance of life history parameters in determining response to exploitation has been demonstrated for a number of species (Jennings et al. 1998, Foster and Vincent 2004).


Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; non-migratory; marine; depth range 15 - 30 m (Ref. 90102)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 6m.
Recorded at 6 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Also found among sponges and algal beds (Ref. 52034).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Male carries the eggs in a brood pouch (Ref. 205). Gestation period 2-3 weeks (but varies with water temperature) (Ref. 30915).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hippocampus comes

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACTTAGTATTTGGTGCTTGAGCCGGAATAGTCGGCACTGCACTCAGCCTATTAATTCGAGCAGAACTAAGTCAGCCAGGAGCTTTACTAGGGGATGATCAAATCTATAATGTTATCGTAACTGCCCATGCTTTCGTAATAATTTTTTTTATAGTAATACCAATTATGATCGGAGGTTTTGGTAATTGATTAGTTCCTTTAATAATTGGAGCGCCTGATATAGCCTTCCCTCGGATAAACAATATGAGTTTTTGATTATTACCTCCTTCTTTCCTCCTTCTCCTTGCCTCATCAGGAGTAGAAGCCGGTGCAGGAACAGGTTGAACTGTTTACCCCCCATTAGCAGGCAACCTAGCACATGCTGGAGCTTCAGTAGACTTAACAATTTTCTCCCTCCATTTAGCAGGTGTTTCGTCAATCCTCGGAGCTATTAACTTTATTACCACTATTATTAATATAAAACCCCCATCAATTTCACAATATCAAACACCACTGTTTGTATGAGCAGTCTTAGTAACTGCAGTTCTACTCTTACTATCCCTGCCTGTATTAGCAGCTGGTATTACTATACTTTTAACAGATCGGAATTTAAATACAACATTCTTTGACCCTTCTGGAGGAGGAGATCCTATTCTCTATCAACACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hippocampus comes

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2bd+4bd

Version
3.1

Year Assessed
2015

Assessor/s
Lim, A.

Reviewer/s
Morgan, S.K., Pollom, R. & Ralph, G.

Contributor/s
Wiswedel, S.

Justification
Hippocampus comes is listed as Vulnerable (VU A2bd+4bd) based on suspected declines of 30-50% caused by incidental catch, targeted catch and habitat degradation. Given that H. comes is among the most commonly traded (Evanson et al. 2011) seahorse species, particularly dried for traditional medicine trade and live for the aquarium trade, evidence of declines in seahorse availability raises concern for this species.

Population decline in other areas outside of the Philippines remain unknown (Morgan and Lourie, 2006) but the abundances of H. comes surveyed in several islands of the Philippines where fishing occurs are low and there is also evidence in declines in the availability of seahorses in general, including H. comes (Perante et al. 2002, Morgan and Lourie, 2006). Although more recent data do not exist, an increasing human population combined with only minor successes in conservation indicate that the threats outlined here are and will be persisting into the future.

A precautionary listing of Vulnerable (VU A2cd+4cd) is warranted, inferring overall numeric declines of 30-50% in the past and future.

History
  • 2002
    Vulnerable (VU)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
While detailed population numbers of H.comes remain unknown, the species has been studied in situ in the central Phillipines since 1995 (Vincent and Parajo 1997, Perante et al. 2002, Morgan and Vincent 2007, Morgan 2008 (PhD thesis)). Densities of Hippocampus comes around Jandayan Island on the north-western edge of Bohol, were low with a mean density of 0.019 m-2, while densities for the other nearby islands (Cataban, Saag, Sagasa and Mahanay Island, Bohol) were even lower, at 0.00143 m-2 (Perante et al. 2002, Morgan and Vincent 2007). Density varies meaningfully by habitat type and life history stage, where juveniles show marked preference for wild macroalgal beds, versus adults which occur in greatest densities in coral reef environments (Morgan and Vincent 2007).

Densities of H.comes appear to respond to Marine Protected Areas (MPA) where a mean density of 0.019 m-2 was recorded inside protected waters on Jandayan Island, Philippines, as compared to densities outside the MPA (0.0005 m-2) (Perante et al. 2002, Marcus et al. 2007). Density estimates in 2007 were the lowest recorded for H.comes with over 90% of surveyed transects containing no seahorses (Marcus et al. 2007). Historical, anecdotal reports from fishers in Bohol mentioned densities up to 20 individual m-2: although there are known discrepancies with historical fisher data (ODonnell et al. 2010) there is no doubt that there has been a significant decrease in seahorse densities in areas with active fisheries.

In Malaysia and Thailand, fishers and traders reported declines in seahorse supply, including Hippocampus comes (Perry et al. 2010). Data from the Convention on the International Trade in Endangered Species (CITES) Trade Database show a decline in trade volume from Thailand (6.5 million individuals in 2004 to 3.7 million individuals in 2008) while Malaysia showed an increasing trend from 2,500 individuals in 2004 to 595,000 individuals in 2008 (Evanson et al. 2011).

The longevity of these animals is estimated to be 3.2 years and the estimated age of maturity is at 3.8 months (Morgan and Vincent 2013). Declines under criterion A must be considered over 10 years, which constitutes longer than three generations. Fishers in Bohol, central Philippines, reported a decline in mean catch per unit effort (CPUE) from 24 seahorses per night per fisher in 19861990 to 2.9 seahorses per night per fisher in 19961999 (Morgan and Lourie 2006). Declines in CPUE have been estimated throughout central Philippines: CPUE in Bohol declined by 67% in lantern fishing between 19802000, Eastern Samar by 93% in lantern fishing CPUE between 19802000, Surigao del Norte by 100% in beach seining CPUE between 19752006 (A. Maypa, unpublished in Morgan and Lourie 2006).

The declines in CPUE over the past show a suspected decline of at least 70% (Vincent and Pajaro 1997, A. Maypa unpublished data in Morgan and Lourie 2006). As the central Philippines is where the species is believed to occur at greatest natural densities, and because it is reasonable that the threats facing this species here would be similar throughout its range (Morgan and Lourie 2006), we conservatively assume a decline of at least 30-50% throughout its range between 1995 and 2005.

More recent data for Hippocampus comes is unavailable, however growing human populations in the range countries indicate that these threats are not likely to have subsided, and likely will not in the near future.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The main threats to Hippocampus comes are direct exploitation, habitat destruction and incidental catch. The species is exploited to supply the traditional medicine, curio and aquarium trades (Perry et al. 2010, Lim et al. 2011). the majority of which is sourced from incidental bycatch in commercial and artisanal fishers throughout its range in Malaysia and Thailand (Choo and Liew 2003, Perry et al. 2010), Vietnam (Giles et al. 2006) and the Philippines (Vincent et al. 2007).

Pressures on H. comes in the central Philippines is particularly high with target capture, destructive fishing and macroalgal farming (Morgan and Vincent 2007). The reefs that comprise a major habitat for this species are threatened by land-based activities such as coastal development, siltation and pollution (Burke et al. 2002). Destructive fisheries such as blast fisheries and cyanide fishing occur throughout the species range, causing coral and seagrass damage (Gomez 1997, Short et al. 2011), These habitats are vital to the ecology of H. comes (Morgan and Vincent 2007) and the decline in suitable habitats throughout the species range raises the probability of decline in population in addition to other threats. Extremely low H. comes densities were reported in areas with poor benthic quality suggesting that activities which reduce the variety of benthic forms may negatively affect the species (Marcus et al. 2007).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Vulnerable (VU) (A2cd)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Hippocampus comes has been studied in situ in the central Philippines since 1995, as part of a conservation program in an area where this species is of considerable economic importance (Vincent and Pajaro unpubl. data). It is listed on CITES Appendix II, and as such all international trade is regulated. Multiple protected areas occur within the species' range, however their efficacy is not well understood.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Tiger tail seahorse

The tiger tail seahorse (Hippocampus comes) is a species of fish in the Syngnathidae family. It is found in India, Indonesia, Malaysia, the Philippines, Singapore, Thailand and Vietnam. Its natural habitats are subtidal aquatic beds and coral reefs. It is threatened by habitat loss.

The tiger tail sea horse lives in Western Central Pacific: Malaysia, Singapore, Thailand, Vietnam, and the Philippines. It lives from 2–3 years. It is harmless. Its climate in water is tropical; 15°N - 1°N and Its maximum size is 18.7 cm. Its snout is 2.2 in head length; it is used to suck up food. They eat small fish, coral, small shrimp, and plankton. The most common pattern is alternating yellow and black. The tail has stripes from the belly to the tip of the tail. These sea horses are normally found in pairs on coral reefs, sponge gardens, kelp, or floating Sargassum. The male carries the eggs in a brood pouch on their chest which holds from 1 - 2,000 eggs and the pregnancy takes from 1 to 4 weeks. It is also used for traditional Chinese medicine. Seahorse populations are thought to have been endangered in recent years by over fishing and habitat destruction. The seahorse is used in traditional Chinese medicine, and as many as 20 million seahorses may be caught each year and sold for this purpose. Import and export of seahorses has been controlled under CITES since May 15, 2004. They don't have scales as fish do, they have more like hard thin skin stretched out around bony rings on their bodies. They swim upright, not horizontally.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!