Overview

Comprehensive Description

Biology

Unlike most seahorses, this species is often found clinging to hard coral and doesn't seem to be worried about stingers (Ref. 48635). Ovoviviparous (Ref. 205). The male carries the eggs in a brood pouch which is found under the tail (Ref. 205). Popular spiny seahorse in aquarium trade; often sold bleached for traditional Chinese medicine. OT=height length.
  • Lourie, S.A., A.C.J. Vincent and H.J. Hall 1999 Seahorses: an identification guide to the world's species and their conservation. Project Seahorse, London. 214 p. (Ref. 30915)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Hippocampus barbouri is the only species of seahorse located entirely in Southeast Asia. Their distribution has been confirmed in Indonesia, Malaysia, and the Philippines.

Biogeographic Regions: oriental (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Hippocampus barbouri is recorded from Indonesia, Malaysia and the Philippines in shallow seagrass beds up to a maximum depth of 10 m (Lourie et al. 2004).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Central Pacific: southern Sulu Sea. International trade is monitored through a licensing system (CITES II, since 5.15.04) and a minimum size of 10 cm applies.
  • Lourie, S.A., A.C.J. Vincent and H.J. Hall 1999 Seahorses: an identification guide to the world's species and their conservation. Project Seahorse, London. 214 p. (Ref. 30915)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Pacific: Philippines and northern Indonesia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Hippocampus barbouri has well developed spines, including a sharp eye and nose spine and a double cheek spine. Their first dorsal spine is the longest and broadest and is curved slightly backward. The tail has a series of long and short spines, and is relatively short in proportion to the body. The snout is slender and striped, and the coronet (i.e., crown) is moderately high with four or five spines. Fine lines radiate out from the eye. Hippocampus barbouri ranges from white to yellow to greenish gray to light brown, and may have reddish brown spots or lines on the body.This species is sexually dimorphic, as males possess brood pouch not present in females. In addition, males average from 11 to 15 cm, whereas females are slightly smaller, ranging from 11 to 13 cm. The maximum height of the H. barbouri is around 15 cm.

Range length: 11 to 15 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: male larger

  • Oconer, E., A. Herrera, E. Amparado, R. Dela Paz, D. Kime. 2003. Reproductive morphology and gonad development of the male seahorse, Hippocampus barbouri Jordan and Richardson 1908. Asia life sciences, 12/1: 27-38.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dorsal spines (total): 0; Dorsal soft rays (total): 1622
  • Lourie, S.A., A.C.J. Vincent and H.J. Hall 1999 Seahorses: an identification guide to the world's species and their conservation. Project Seahorse, London. 214 p. (Ref. 30915)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 145 mm OT
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

15.0 cm OT (male/unsexed; (Ref. 48635))
  • Kuiter, R.H. and T. Tonozuka 2001 Pictorial guide to Indonesian reef fishes. Part 1. Eels- Snappers, Muraenidae - Lutjanidae. Zoonetics, Australia. 302 p. (Ref. 48635)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description: (based on 19 specimens). Adult height: 7.8-14.5 cm. Rings: 11 + 34-35 (33-36). Snout length: 2.2-2.3 (2.0-2.6) in head length. Dorsal fin rays: 19 (16-22) covering 2+1 rings.Pectoral fin rays: 17-18 (15-20). Coronet: medium-high; five sharp spines. Spines: well-developed, usually quite sharp eye spine; first dorsal trunk spine much longer than others and curved backwards; tail spines of different lengths (in regular series e.g. long, short, long, short).Other distinctive characters: double cheek spines, double spines below eye.Color pattern: white to pale yellow to pale brown; reddish brown spots and lines on body; snout often striped; fine lines radiating from eye.
  • Lourie, S.A., A.C.J. Vincent and H.J. Hall 1999 Seahorses: an identification guide to the world's species and their conservation. Project Seahorse, London. 214 p. (Ref. 30915)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Hippocampus barbouri
Catalog Number: USNM 61683
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): R. McGregor
Locality: Cuyo, Philippine Ids., Philippines, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Hippocampus barbouri is a shallow water species that inhabits sea grass beds, as well as mangrove swamps, estuarine, and muddy areas less than ten meters deep. Their habitats are found scattered along coastlines and in sheltered bays. Oftentimes, this seahorse is associated with calcareous seaweed.

Range depth: 10 (high) m.

Habitat Regions: tropical ; saltwater or marine

Aquatic Biomes: coastal

Wetlands: swamp

  • Kuang, C., L. Chark. 2004. A record of seahorse species (family Syngnathidae) in East Malaysia, with notes on their conservation. Malayan Nature Journal, 56/4: 409-420.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This seahorse occupies shallow seagrass beds up to a maximum depth of 10 m (Lourie et al. 2004). This species may be particularly susceptible to decline due to it occurring in this very vulnerable in-shore habitat (Short et al. 2011) and having ecological and life-history traits that are susceptible to exploitation (Foster and Vincent 2004).

All seahorse species have vital parental care, and many species studied to date have high site fidelity (Perante et al. 2002, Foster and Vincent 2004), highly structured social behaviour (Vincent and Sadler 1995), and relatively sparse distributions (Lourie et al. 1999); these traits make seahorses vulnerable to harvest. There are some traits, such as small body size, fast growth and high fecundity that may make seahorses more resilient to exploitation (Morgan 2007). However a specialised life-history coupled with a dependence on shallow habitats that are subject to extremely high fishing pressure, and the fact that seahorses do not move very much and are thus easily captured, means they are very vulnerable to over-exploitation. The importance of life history parameters in determining response to exploitation has been demonstrated for a number of species, including seahorses (Jennings et al. 1998, Foster and Vincent 2004).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; non-migratory; marine; depth range 6 - 12 m (Ref. 90102)
  • Allen, G.R. and M.V. Erdmann 2012 Reef fishes of the East Indies. Perth, Australia: Universitiy of Hawai'i Press, Volumes I-III. Tropical Reef Research. (Ref. 90102)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 37 - 38.4
  Temperature range (°C): 27.590 - 27.590
  Nitrate (umol/L): 0.954 - 0.954
  Salinity (PPS): 34.202 - 34.202
  Oxygen (ml/l): 4.381 - 4.381
  Phosphate (umol/l): 0.177 - 0.177
  Silicate (umol/l): 2.202 - 2.202

Graphical representation

Depth range (m): 37 - 38.4
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Although there is little information on the diet of the Hippocampus barbouri in the wild, their sedentary nature likely restricts them to zooplankton and phytoplankon, which they ingest via the snout.

Animal Foods: zooplankton

Plant Foods: phytoplankton

Foraging Behavior: filter-feeding

Primary Diet: planktivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

There is no information available concerning the potential ecosystem roles of Hippocampus barbouri.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Hippocampus barbouri is most vulnerable during its juvenile stage, and many piscivorous fish and invertebrates likely prey upon it. Its texture and coloration help camouflage it from potential predators and the numerous spines covering its body likely make them unappealing to predators. Although there is no information available regarding predators specific to this species, potential predators may include large pelagic fishes, skates, rays, penguins, and various reef-dwelling water birds.

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

There is no information available concerning communication and perception in Hippocampus barbouri. However, all fish have a lateral line system that allows them to perceive changes in temperature and pressure in the surrounding environment, and their eyes allow them to receive visual stimulation as well.

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

There is no information available regarding the development of Hippocampus barbouri.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Male carries the eggs in a brood pouch (Ref. 205).
  • Breder, C.M. and D.E. Rosen 1966 Modes of reproduction in fishes. T.F.H. Publications, Neptune City, New Jersey. 941 p. (Ref. 205)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

There is no information available regarding the average lifespan of Hippocampus barbouri. Maintaining seahorses in aquaria has a low success rate due to complications such as a need for large quantities of food, failure to recognize signs of starvation, and problems with external parasites and bacterial pathogens.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Like many seahorses, Hippocampus barbouri is monogamous and mates multiple times in a season, sometimes with the same partner over multiple breeding seasons. Females deposit their eggs into the male's brood pouch, which is separated from the body cavity by a wall of cartilage. Like other seahorses, males carry eggs during development and manipulate them using a modified anal fin. Throughout pregnancy, males and females strengthen pair bonds with daily greetings.

Mating System: monogamous

Gestation in Hippocampus barbouri lasts 12 to 14 days, and typical brood size ranges from 10 to 250 offspring. Hippocampus barbouri is ovoviviparous and gives birth to rather large young, averaging 5mm in length. Juveniles are independent immediately upon birth. Newborns attach themselves to substrate shortly after birth. Most males are reproductively mature by 8 cm in length, as indicated by the presence of a brood pouch and a fully developed reproductive system.

Breeding interval: Seahorses mate soon after giving birth.

Range number of offspring: 10 to 250.

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); ovoviviparous

Hippocampus barbouri males carry developing eggs until birth, after which adults provide no parental care to young as juveniles are immediately independent.

Parental Investment: pre-hatching/birth (Protecting: Male)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hippocampus barbouri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACTTAGTATTTGGTGCTTGGGCCGGAATAGTCGGCACTGCACTCAGCCTATTGATTCGAGCAGAACTAAGTCAGCCAGGAGCTTTACTAGGGGATGATCAAATCTATAATGTTATCGTAACTGCCCATGCTTTCGTAATAATTTTTTTTATGGTAATACCAATTATGATTGGAGGGTTTGGTAATTGATTAGTTCCTTTAATAATCGGGGCGCCTGATATAGCCTTCCCTCGGATAAACAACATAAGTTTTTGATTACTACCACCTTCTTTCCTCCTCCTCCTTGCCTCATCAGGAGTAGAAGCCGGTGCAGGAACAGGTTGGACTGTTTACCCCCCATTAGCGGGCAACCTAGCACACGCTGGAGCTTCTGTAGACTTAACAATTTTCTCGCTCCACTTAGCAGGTGTTTCATCAATCCTAGGAGCTATCAACTTTATTACTACTATTATTAACATAAAACCCCCATCAATCTCACAATATCAGACACCATTATTTGTATGAGCAGTTTTAGTAACTGCAGTTCTACTTCTACTGTCCTTACCTGTACTAGCAGCTGGTATTACAATACTTTTAACAGACCGAAATTTAAACACAACATTCTTTGACCCTTCTGGAGGAGGAGACCCCATTCTTTACCAACACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hippocampus barbouri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Hippocampus barbouri is classified as vulnerable on the IUCN's Red List of Threatened Species. This species is widely targeted for the aquaria trade and accidental capture by non-selective fishing gear poses a significant threat to its long-term survival. In addition, sea grass habitats, which are an important component of H. barbouri habitat, are currently threatened due to trawling practices. In general, seahorses are commonly sold in tonic foods in traditional Chinese medicine, as curiosities, and for live ornamental display. This species is currently listed under CITES Appendix II.

CITES: appendix ii

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2cd+4cd

Version
3.1

Year Assessed
2012

Assessor/s
Wiswedel, S.

Reviewer/s
O’Donnell, K. & Foster, S.

Contributor/s

Justification
Details of declines in Hippocampus barbouri populations are sparse, but the existing indirect evidence suggests cause for concern, especially as H. barbouri is among the more commonly traded species internationally (Evanson et al, 2011, UNEP–WCMC 2012a). Due to this extensive and continuing trade, coupled with mortality from ever-present bycatch and destruction of its seagrass habitats, a continuing decline of at least 30% is suspected in the past and into the future. Using the precautionary approach, this species is assessed as Vulnerable under criterion A.

In 2002 this species was assessed as VU A4cd. This species was also assessed in 1996 under the name Hippocampus histrix but this identification was an error.

History
  • 2002
    Vulnerable
  • 1996
    Vulnerable
    (Baillie and Groombridge 1996)
  • 1996
    Vulnerable
  • 1996
    Vulnerable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Population estimates for Hippocampus barbouri are currently unknown but trade surveys conducted by Project Seahorse have shown that this species is widely traded for traditional medicine, the aquarium trade and for curios (Vincent 1996, Perry et al. 2010, Evanson et al. 2011). There is also evidence from fisher surveys that there have been local declines in seahorse numbers generally in Malaysia and the Philippines (O'Donnell et al. 2010, Perry et al. 2010) and it can be suspected that similar reductions are occurring throughout this species' range where the same threats are found.

Respondents at various levels of trade (including fishers, buyers, wholesalers, retailers, exporters and officials) in 1998 and 1999 in Malaysia reported declines in seahorse numbers and availability and that H. barbouri was one of the most common species traded (Perry et al. 2010). In the Philippines seahorse fishers also reported high levels of decline between 1970 and 2003 (O'Donnell et al. 2010). Although this study did not focus on H. barbouri, these trends are indicative of seahorse populations in the area where this species occurs. The fishers in the Philippines cited overfishing, the increasing population of fishers and indiscriminate catch of seahorses, including pregnant and immature seahorses, as causes of the observed decline in catch.

General seahorse population declines within H. barbouri's range are suspected as a result of habitat degradation and declines in seagrasses (Marcus et al. 2007, Short et al. 2011), and mortality from intense trawling bycatch (Baum et al. 2003, Giles et al. 2006, Perry et al. 2010) — and indeed these threats are known to occur throughout this species’ range (FAO 2001, Perry et al. 2010). Declines in seagrasses are particularly concerning as this is H. barbouri's primary habitat. In addition, H. barbouri is reported in international trade in large volumes (Evanson et al. 2011, UNEP–WCMC 2012a). Trade in this species has been reported from as early as 1998 in Malaysia (Perry et al. 2010), and since the implementation of the listing of all Hippocampus species in 2004 on Appendix II of CITES (Evanson et al. 2011, UNEP-WCMC 2012a). The large and potentially unregulated numbers of H. barbouri in international trade led this species to be selected by the CITES Animals Committee for the Review of Significant Trade following COP15 (UNEP–WCMC 2012b). Thus, this major threat has been acting on this species for more than ten years, and it is reasonable to suspect that trade will continue into the future.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The main threat to Hippocampus barbouri is exploitation for trade for traditional medicine and aquaria display. Although this seahorse has spines on its body, which is traditionally an undesirable trait in the traditional medicine trade (Vincent 1996), it is still heavily traded (Evanson et al. 2011). This seahorse is a bycatch in multiple fisheries in its shallow seagrass habitat as well as being targeted by some small-scale fishers (Perry et al. 2010).

In addition to the substantial demand for this species, its in-shore seagrass habitats are also threatened throughout its range. Major threats faced by seagrasses include; eutrophication, sedimentation, coastal construction, dredging and invasive species and these threats result in decline in and fragmentation of seagrass habitats (see Short et al. 2011 for an overview of threats facing seagrasses).

Seahorses' life history and ecological traits may increase their susceptibility to these threats (see Habitats and Ecology).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Vulnerable (VU) (A2cd+4cd)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
All Hippocampus species are listed under Appendix II of the Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES). This means that countries who are signatories to CITES are subject to regulations on the export of seahorses. Countries are required to provide permits for all exports of seahorses and are meant to provide evidence that these exports are not detrimental to wild populations. However a lack of basic information on distribution, habitat and abundance means many CITES Authorities cannot assess sustainability of their seahorse exploitation and meet their obligations to the Convention. The challenge is particularly large in that most seahorses entering trade are caught incidentally as bycatch and thus imposing export quotas would achieve next to nothing for wild populations.

CITES has recommended a minimum size limit of 10 cm height for all seahorse specimens in trade (CITES Decision 12.54). This limit represents a compromise between the best biological information available at the time of listing and perceived socioeconomic feasibility. But we urgently need information on wild populations to assess their conservation status and take conservation action, as well as refine management recommendations. For example, evidence on variation in the spatial and temporal abundance of seahorses would enable areas of high seahorse density to be identified, as the basis for considering area restrictions on non-selective fishing gear that obtains Hippocampus species as bycatch. An understanding of the technical and logistical feasibility of returning to the sea live seahorses taken as bycatch in various types of fishing gear would provide the basis for considering the feasibility of minimum size limits and/or other output controls. Establishing monitoring program of landings of seahorses at representative sites, taking into account different gear types and means of extraction and recording catch and effort metrics would allow us to assess population conservation status and develop management recommendations for various fishery types.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

There are no known adverse effects of Hippocampus barbouri on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

There is no information on the economic importance of Hippocampus barbouri. In China, seahorses are used in a variety of traditional medicines.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Importance

fisheries: subsistence fisheries; aquarium: commercial
  • Lourie, S.A., A.C.J. Vincent and H.J. Hall 1999 Seahorses: an identification guide to the world's species and their conservation. Project Seahorse, London. 214 p. (Ref. 30915)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Barbour's seahorse

Barbour's seahorse (Hippocampus barbouri) is a species of seahorse. It is found in Indonesia, Malaysia, and the Philippines. Its natural habitat is subtidal aquatic beds. It is threatened by habitat loss. It is often confused with the Hedgehog seahorse, H. histrix.



References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!