Overview

Comprehensive Description

Biology

Presumably on rocky slopes in deep water of 150-200 m. Fricke et al. (Ref. 33470) observed two specimens of 120 and 140 cm length in a deep carbonate cave at a depth of 155 m (water temp. 17.8-20.1°C).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is known from the Celebes Sea, north of Sulawesi in Indonesia. It is only known only from three localities. The first two specimins were caught on Manado Tua in September 1997 and July, 1998. Another was caught in Manado Bay in May, 2007. The third site is northern Suluwesi near Dondo Bay, slightly to the east on Tanjum Kandi. The animal from the Dondo Bay site was observed in the Jago submersible in November 1999. The Tanjum Kandi sighting was in June 2006 from the Fukushima Aquamarine Aquarium ROV.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indonesia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Central Pacific: Celebes Sea, north of Sulawesi. Also Ref. 33470. International trade banned (CITES Appendix I, since 19.7.2000).
  • Erdmann, M.V., R.L. Caldwell, S.L. Jewett and A. Tjakrawidjaja 1999 The second recorded living coelacanth from North Sulawesi. Environ. Biol. Fish. 54(4):445-451. (Ref. 30891)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 1240 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

140 cm TL (male/unsexed; (Ref. 33470))
  • Fricke, H., K. Hissmann, J. Schauer, M. Erdmann, M.K. Moosa and R. Plante 2000 Biogeography of coelacanths. Nature 403:38. (Ref. 33470)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This is a demersal, non-migratory marine species found in deep water between 150-200m depth. It lives in water temperatures from 17-20°C. It is presumably found in rocky slopes and caves. Fricke et al. (2000) observed two specimens of 120 and 140 cm length in a deep carbonate cave at a depth of 155 m (water temp. 17.8-20.1°C). Latimeria menadoensis is presumed to be very slow growing and long lived, with very low fecundity (maximum of around 50 for congeneric species), similar to sharks. Females produce large, orange-sized eggs which hatch within the oviduct before the female gives birth to live young. The autopsy of the Sulawesi Coelacanth that was caught in May 2007 in Bunaken National Marine Park, showed that in fact the fish was pregnant. Scientists in Indonesia, France and Japan are currently conducting research to better understand the reproductive biology of this fish.

Though scientists have never observed coelacanths feeding in their natural habitat, analyses of stomach contents of captured specimens have shown that their diet includes cuttlefish, squid, and various small to medium-sized benthic fishes – including lantern fishes, cardinal fishes and deepwater snappers.

Coelacanths can weigh up to 100 kg, though an average size is closer 30 kg.They may live to an age of at least 22 years.

There are many unanswered questions about the ecology of Latimeria manadoensis.

A unique combination of morphological features suggest that the coelacanth lineage is close to the origin of the evolution of early terrestrial, four-legged animals (tetrapods) like amphibians. The most remarkable of these features is the presence of seven lobed fins, unique among the living fishes. The paired fins move in an alternating fashion which resembles a horse in a slow trot. Other interesting features include a small secondary "epicaudal" lobe on its tail, an oil-filled notochord instead of a backbone, an intercranial joint which is thought to allow them to widen their gape when capturing prey, and a unique electrosensory rostral organ that may be used to detect prey. While their morphological features lead many scientists to believe the coelacanth lineage was the direct link to tetrapods, recent molecular evidence suggests that lung fish might be more closely related to tetrapods (University of California Museum of Paleontology, website).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; non-migratory; marine, usually 150 - ? m (Ref. 33470)
  • Fricke, H., K. Hissmann, J. Schauer, M. Erdmann, M.K. Moosa and R. Plante 2000 Biogeography of coelacanths. Nature 403:38. (Ref. 33470)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Presumably on rocky slopes in deep water of 150-200 m. Fricke et al. (Ref. 33470) observed two specimens of 120 and 140 cm length in a deep carbonate cave at a depth of 155 m (water temp. 17.8-20.1°C).
  • Fricke, H., K. Hissmann, J. Schauer, M. Erdmann, M.K. Moosa and R. Plante 2000 Biogeography of coelacanths. Nature 403:38. (Ref. 33470)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Latimeria menadoensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGATAATCACTCGTTGACTATTCTCAACCAACCACAAAGATATTGGTACCCTATACATGATTTTCGGGGCCTGAGCTGGAATAGTTGGAACCGCTCTAAGCCTACTTATTCGAGCCGAACTCAGCCAACCTGGAGCTCTCCTAGGCGACGACCAAATTTACAATGTAATTGTCACAGCACATGCATTCGTGATAATCTTCTTTATAGTAATACCAGTCATAATTGGCGGGTTTGGCAACTGACTAATTCCCCTGATGATTGGGGCACCAGACATAGCATTTCCACGTATAAACAACATAAGCTTCTGACTATTACCGCCCTCACTCCTACTCCTACTAGCATCCTCTGGAGTAGAAGCAGGAGCAGGCACAGGATGAACAGTATACCCTCCGCTAGCGAGCAACCTCGCCCATGCAGGAGCATCAGTAGACCTAACAATTTTCTCCTTACATCTGGCCGGTGTATCCTCAATCTTAGGGGCCATCAACTTCATCACAACAGTAATCAACATAAAACCCCCAACAATAACACAATATCAGACACCGCTATTTATCTGATCAGTCTTAGTGACCGCCGTACTACTCCTACTCTCGCTACCAGTGCTAGCTGCCGGAATTACCATACTACTGACAGATCGAAATCTAAACACAACATTCTTTGACCCTGCTGGAGGAGGAGACCCTATTCTATACCAACACCTATTCTGATTCTTTGGTCACCCCGAAGTGTACATCCTAATTTTACCAGGATTTGGTATAATCTCACACATTGTGGCCTACTACTCCGGGAAAAAAGAACCATTCGGGTATATAGGTATAGTATGAGCTATAATAGCAATTGGACTACTAGGCTTCATCGTATGAGCCCATCATATATTTACCGTAGGAATGGATGTTGACACACGAGCATACTTTACATCAGCAACCATAATTATTGCCATCCCAACAGGAGTAAAAGTATTCAGCTGACTAGCGACACTTCACGGAGGAGTGACCAAATGAGACACACCCCTGCTATGAGCACTAGGGTTTATCTTTCTTTTTACAGTAGGAGGCCTAACGGGCATCGTACTGGCAAACTCATCACTAGACATCATCCTACATGACACTTATTATGTAGTAGCACACTTCCACTATGTCCTATCAATAGGAGCAGTATTTGCAATCATGGGTGGACTCGTGCACTGATTTCCATTAATAACAGGATACACCTTACACAACACATGAACAAAAATCCACTTTGGTGTAATATTTACAGGAGTAAACCTAACATTTTTCCCACAACACTTCCTCGGACTAGCAGGTATACCACGACGTTACTCAGACTATCCAGATGCCTATACTTTATGAAATACAGTATCATCAATCGGCTCCCTAATTTCACTAATTGCCGTAATCATATTTATATTTATCCTGTGGGAAGCTTTCTCCGCCAAACGAGAAGTACTAATTGTAGAAATAACAACAACAAATGTGGAATGACTACACGGATGCCCACCACCACACCACACATATGAAGAACCAGCATTCGTACAAGCTCGATAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Latimeria menadoensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
C2a(ii); D2

Version
3.1

Year Assessed
2008

Assessor/s
Erdmann, M.

Reviewer/s
Carpenter, K. & Livingstone, S. (Global Marine Species Assessment Coordinating Team)

Contributor/s

Justification
Latimeria menadoensis is only known from three locations in northern Sulawesi, Indonesia and very few specimens have been seen. It is thought to be naturally rare with a population of less than 10,000 mature adults. This is a slow growing species with low fecundity, and therefore is naturally susceptible to over-exploitation. Major threats are bycatch in deep set shark nets and hook and line fishing for deepwater groupers. There is no population information available and nothing is known about current trends. Due to small number of localities known, and the life history, suspected low population size, and threats from bycatch, Latimeria menadoensis is listed as Vulnerable under criteria D2 and C2a (ii).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The population status of this species is unknown. It is believed to be a naturally small population (suspected to be less than 10,000 mature adults) and rare. A population study has never been undertaken and the species is very rarely caught by fisherman. One experienced fisherman informed that during his life as a fisherman this species was caught no more than 30 times, or not more than one or two times per year (M. Erdmann pers. comm.). The growth of its population is likely to be very slow, similar to Latimeria chalumnae. The shark fishermen at Menado Tua Island generally catch 1-2 individuals of L. menadoensis once every 5-10 years as bycatch (Erdmann and Kasim Moosa, pers. comm.). In northern Sulawesi, all fishermen are aware of this species and would report it if caught.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Latimeria menadoensis has a very low population size and its life history makes it a species with higher extinction risk due to slow growth and low fecundity. This is not a commercial species and has no food value, but is caught as bycatch by deep shark nets and by hook and line targeting deepwater snapper.

This species is an extremely sought after aquarium fish, although no specimen has ever been successfully kept alive for aquarium display.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Vulnerable (VU) (C2a(ii); D2)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is protected locally by Indonesian regulations and internationally by CITES, which includes all Latimeria species (CITES Appendix I, since 2000).

This species needs further research in all aspects of its ecology and biology and to determine the extent of its distribution, population size and trends. However it is an extremely difficult and expensive animal to study due to it's habitat time and deep water living.

Shark nets were outlawed in Bunaken National Park which includes Manado Tua where the first individuals were caught.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Indonesian coelacanth

The Indonesian coelacanth (Latimeria menadoensis, Indonesian: raja laut) is one of two living species of coelacanth, identifiable by its brown color. It is listed as vulnerable by the IUCN.[1] The other species, L. chalumnae (West Indian Ocean coelacanth) is listed as critically endangered.[2]

Discovery[edit]

Latimeria menadoensis featured in Indonesian stamp

On September 18, 1997, Arnaz and Mark Erdmann, traveling in Indonesia on their honeymoon, saw a strange fish enter the market at Manado Tua, on the island of Sulawesi.[3] Mark thought it was a gombessa (Comoro coelacanth), although it was brown, not blue. An expert noticed their pictures on the Internet and realized its significance. Subsequently, the Erdmanns contacted local fishermen and asked for any future catches of the fish to be brought to them. A second Indonesian specimen, 1.2 m in length and weighing 29 kg., was captured alive on July 30, 1998.[4] It lived for six hours, allowing scientists to photographically document its coloration, fin movements and general behavior. The specimen was preserved and donated to the Museum Zoologicum Bogoriense (MZB), part of the Indonesian Institute of Sciences (LIPI).[3]

DNA testing revealed that this specimen differed genetically from the Comorian population.[5][6] Superficially, the Indonesian coelacanth, locally called raja laut ("King of the Sea"), appears to be the same as those found in the Comoros except that the background coloration of the skin is brownish-gray rather than bluish. This fish was described in a 1999 issue of Comptes Rendus de l'Académie des sciences Paris by Pouyaud et al. It was given the scientific name Latimeria menadoensis.[7] In 2005, a molecular study estimated the divergence time between the two coelacanth species to be 40–30 mya.[8]

References[edit]

  1. ^ a b Erdmann, M. (2008). "Latimeria menadoensis". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 2013-12-23. 
  2. ^ Musick, J. A. (2000). "Latimeria chalumnae". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 2013-12-23. 
  3. ^ a b Jewett, Susan L., "On the Trail of the Coelacanth, a Living Fossil", The Washington Post, 1998-11-11, Retrieved on 2007-06-19.
  4. ^ Nelson, Joseph S. (2006). Fishes of the World. John Wiley & Sons, Inc. ISBN 0-471-25031-7
  5. ^ Erdmann, Mark V. (April 1999). "An Account of the First Living Coelacanth known to Scientists from Indonesian Waters". Environmental Biology of Fishes (Springer Netherlands) 54 (#4): 439–443. doi:10.1023/A:1007584227315. 0378-1909 (Print) 1573-5133 (Online). Retrieved 2007-05-18. 
  6. ^ Holder, Mark T., Mark V. Erdmann, Thomas P. Wilcox, Roy L. Caldwell, and David M. Hillis (1999). "Two living species of coelacanths?". Proceedings of the National Academy of Sciences of the United States of America 96 (22): 12616–12620. doi:10.1073/pnas.96.22.12616. PMC 23015. PMID 10535971. 
  7. ^ Pouyaud, L., S. Wirjoatmodjo, I. Rachmatika, A. Tjakrawidjaja, R. Hadiaty, and W. Hadie (1999). "Une nouvelle espèce de coelacanthe: preuves génétiques et morphologiques". Comptes Rendus de l'Académie des sciences Paris, Sciences de la vie / Life Sciences 322 (4): 261–267. doi:10.1016/S0764-4469(99)80061-4. PMID 10216801. 
  8. ^ Inoue J. G., M. Miya, B. Venkatesh, and M. Nishida (2005). "The mitochondrial genome of Indonesian coelacanth Latimeria menadoensis (Sarcopterygii: Coelacanthiformes) and divergence time estimation between the two coelacanths". Gene 349: 227–235. doi:10.1016/j.gene.2005.01.008. PMID 15777665. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!