Overview

Distribution

Central America: Usumacinta River basin.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Usumacinta River basin, Guatemala.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Max. size

6.8 cm SL (male/unsexed; (Ref. 38376))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

benthopelagic; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bramocharax baileyi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATTTAGTATTTGGTGCCTGAGCTGGGATGGTTGGGACTGCTTTAAGCCTGTTAATTCGGGCAGAGCTCGGCCAACCGGGATCCCTTCTAGGTGATGACCAGGTATATAATGTTCTGGTAACTGCACATGCTTTCGTTATAATTTTCTTTATAGTTATACCCGTTATAATTGGAGGCTTTGGAAACTGGCTAGTCCCACTTATAATTGGCGCCCCAGACATAGCCTTCCCTCGAATAAATAACATAAGTTTTTGACTTCTCCCACCATCTTTTCTTCTCCTTCTAGCATCCTCTGGGGTCGAGGCTGGAGCAGGAACAGGATGAACTGTATACCCCCCTCTTGCTGGCAACCTTGCACATGCAGGAGCTTCCGTTGACTTAACTATTTTCTCACTACACTTGGCTGGTGTCTCCTCAATTTTAGGAGCAATCAATTTTATTACAACTATTATTAATATAAAACCCCCAGCTATTTCGCAATACCAGACACCCTTATTTGTCTGGGCTGTCTTAGTGACAGCTGTCCTCCTTCTTCTTTCACTCCCTGTCTTAGCAGCAGGTATCACAATACTTCTTACAGATCGTAACCTTAATACTTCATTTTTTGACCCGGCGGGAGGTGGAGATCCCATCCTTTATCAACACCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Bramocharax baileyi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!