Overview
Comprehensive Description
Biology
Known from the continental shelves, sometimes at depths greater than 130 m (Ref. 57879). Ovoviviparous (Ref. 559).
-
Randall, J.E. and K.K.P. Lim (eds.) 2000 A checklist of the fishes of the South China Sea. Raffles Bull. Zool. Suppl. (8):569-667. (Ref. 36648)
http://www.fishbase.org/references/FBRefSummary.php?id=36648&speccode=61658
Trusted
Distribution
Western Pacific: southern Japan (Ref. 41299) to the South China Sea.
-
Randall, J.E. and K.K.P. Lim (eds.) 2000 A checklist of the fishes of the South China Sea. Raffles Bull. Zool. Suppl. (8):569-667. (Ref. 36648)
http://www.fishbase.org/references/FBRefSummary.php?id=36648&speccode=61658
Trusted
Range Description
Northwest Pacific: southern Japan to the South China Sea including Ryukyu Islands and Viet Nam (Last et al. 2007).
Trusted
Physical Description
Size
Max. size
60.0 cm TL (male/unsexed; (Ref. 41299))
-
Nakabo, T. 2002 Fishes of Japan with pictorial keys to the species, English edition I. Tokai University Press, Japan, pp v-866. (Ref. 41299)
http://www.fishbase.org/references/FBRefSummary.php?id=41299&speccode=4669
Trusted
Ecology
Habitat
Environment
demersal; marine; depth range ? - 130 m (Ref. 41299)
-
Nakabo, T. 2002 Fishes of Japan with pictorial keys to the species, English edition I. Tokai University Press, Japan, pp v-866. (Ref. 41299)
http://www.fishbase.org/references/FBRefSummary.php?id=41299&speccode=4669
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
Habitat and biology are poorly known. The largest catalogued specimen is a female measuring 55.2 cm total length (TL). Adult males measure ~45 cm TL (Last et al. 2007).
Systems
- Marine
Trusted
Trophic Strategy
Known from the continental shelves, sometimes at depths greater than 130 m (Ref. 57879).
-
Chinese Academy of Fishery Science (CAFS) 2007 Database of genetic resources of aquatic organisms in China (as of January 2007). Chinese Academy of Fishery Science. (Ref. 57879)
http://www.fishbase.org/references/FBRefSummary.php?id=57879&speccode=63318
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Squalus brevirostris
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 8 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 8 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
CCTTTATTTAATCTTTGGTGCATGAGCAGGAATAGTAGGCACCGCCCTTAGCTTACTCATTCGAGCAGAATTAAGCCAGCCTGGAACACTCCTGGGAGATGATCAAATCTATAATGTTATCGTAACTGCTCACGCTTTTGTAATAATCTTTTTCATAGTTATGCCTGTAATAATCGGTGGATTCGGAAACTGATTAGTACCTTTAATAATTGGTGCACCAGACATAGCTTTTCCACGGATAAATAATATAAGCTTTTGATTGTTGCCCCCCTCCCTCCTGCTACTCTTAGCCTCTGCTGGTGTAGAAGCAGGAGCCGGAACCGGCTGAACAGTTTACCCCCCGCTAGCAGGTAATATAGCCCATGCTGGCGCATCCGTAGACCTGGCCATCTTCTCACTCCATTTGGCTGGTATTTCCTCAATTTTAGCCTCTATTAATTTTATCACAACTATTATTAACATAAAACCTCCTGCCATCTCTCAGTATCAAACACCACTCTTTGTCTGATCCATCCTTGTAACCACCGTTCTTCTTCTTCTTTCCCTCCCGGTCCTCGCAGCCGCAATTACGATACTATTAACTGACCGTAATTTAAACACAACATTTTTTGATCCTGCAGGGGGAGGAGACCCAATTCTCTACCAACACTTANNN
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Squalus brevirostris
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 12
Species With Barcodes: 1
Public Records: 9
Specimens with Barcodes: 12
Species With Barcodes: 1
Trusted
Conservation
Conservation Status
IUCN Red List Assessment
Red List Category
DD
Data Deficient
Red List Criteria
Version
3.1
Year Assessed
2009
Assessor/s
White, W.T.
Reviewer/s
Valenti, S.V., Tanaka, S. & Fowler, S.L. (Shark Red List Authority)
Contributor/s
Justification
The Japanese Shortnose Spurdog (Squalus brevirostris) is a dogfish occurring from Southern Japan to the South China Sea including Ryukyu Islands and Vietnam. Japanese Shortnose Spurdog from the northwest Pacific has previously been considered a synonym of the Piked Spurdog (Squalus megalops), however a recent study revealed that this species is clearly separable from the true S. megalops from Australia. Misidentification of Squalus species in the northwest Pacific is an issue and affects the quality of data available. This species is apparently still commonly caught in deepwater demersal fisheries in Japan and Taiwan, Province of China. There is little information currently available and it is probably confused with other Squalus species in the literature. The lack of information precludes an assessment beyond Data Deficient at present and efforts should be made to quantify bycatch and to determine population trends.
Trusted
Trends
Population
Population
Population Trend
Commonly caught in some areas of Japan and Taiwan and appears to be relatively abundant.
Population Trend
Unknown
Trusted
Threats
Data deficient (DD)
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
Trusted
Major Threats
Caught by bottom trawls and longlines in some parts of its range. Fisheries off the eastern coast of Taiwan, Province of China have moved into deeper water over the past 20 years, particularly around Ta-Shi, from 100?300 m fishing depth to >300 m currently (D. Ebert pers. comm. 2007).
Squlaus species are recorded in catches off Vietnam (SEAFDEC 2006) but nothing is known of the amount of this species taken or the level and impact of fisheries on this species. For example, bottom longline fisheries operate around the Paracel islands, Vietnam at depths >100 m. Sharks account for 45?100% of the total catch with 400?4,000 kg captured per boat (N. long pers. comm. 2007), however, no species specific information is available. In southern Vietnam, off Phu Quy island only about a 100 boats are still targeting sharks due to a general decline in the level of shark catch (N. long pers. comm. 2007), however no data are available to confirm which species have been impacted. In this area fishing boats have switched to targeting snapper and grouper or cuttlefish and squid (N. long pers. comm. 2007).
Other Squalus species in the northwest and Western Central Pacific are targeted and valuable for their liver oil, however, because of species misidentification and confusion no specific information on the utilization of this species is currently available.
Squlaus species are recorded in catches off Vietnam (SEAFDEC 2006) but nothing is known of the amount of this species taken or the level and impact of fisheries on this species. For example, bottom longline fisheries operate around the Paracel islands, Vietnam at depths >100 m. Sharks account for 45?100% of the total catch with 400?4,000 kg captured per boat (N. long pers. comm. 2007), however, no species specific information is available. In southern Vietnam, off Phu Quy island only about a 100 boats are still targeting sharks due to a general decline in the level of shark catch (N. long pers. comm. 2007), however no data are available to confirm which species have been impacted. In this area fishing boats have switched to targeting snapper and grouper or cuttlefish and squid (N. long pers. comm. 2007).
Other Squalus species in the northwest and Western Central Pacific are targeted and valuable for their liver oil, however, because of species misidentification and confusion no specific information on the utilization of this species is currently available.
Trusted
Management
Conservation Actions
Conservation Actions
None in place. Efforts should be made to collect species specific catch data. Future surveys should aim to further define this species? distribution and identify population trends.
Trusted


