Overview

Comprehensive Description

Biology

Known from the continental shelves, sometimes at depths greater than 130 m (Ref. 57879). Ovoviviparous (Ref. 559).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Pacific: southern Japan (Ref. 41299) to the South China Sea.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Northwest Pacific: southern Japan to the South China Sea including Ryukyu Islands and Viet Nam (Last et al. 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western North Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Max. size

60.0 cm TL (male/unsexed; (Ref. 41299))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; marine; depth range ? - 130 m (Ref. 41299)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Habitat and biology are poorly known. The largest catalogued specimen is a female measuring 55.2 cm total length (TL). Adult males measure ~45 cm TL (Last et al. 2007).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Known from the continental shelves, sometimes at depths greater than 130 m (Ref. 57879).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Squalus brevirostris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTAATCTTTGGTGCATGAGCAGGAATAGTAGGCACCGCCCTTAGCTTACTCATTCGAGCAGAATTAAGCCAGCCTGGAACACTCCTGGGAGATGATCAAATCTATAATGTTATCGTAACTGCTCACGCTTTTGTAATAATCTTTTTCATAGTTATGCCTGTAATAATCGGTGGATTCGGAAACTGATTAGTACCTTTAATAATTGGTGCACCAGACATAGCTTTTCCACGGATAAATAATATAAGCTTTTGATTGTTGCCCCCCTCCCTCCTGCTACTCTTAGCCTCTGCTGGTGTAGAAGCAGGAGCCGGAACCGGCTGAACAGTTTACCCCCCGCTAGCAGGTAATATAGCCCATGCTGGCGCATCCGTAGACCTGGCCATCTTCTCACTCCATTTGGCTGGTATTTCCTCAATTTTAGCCTCTATTAATTTTATCACAACTATTATTAACATAAAACCTCCTGCCATCTCTCAGTATCAAACACCACTCTTTGTCTGATCCATCCTTGTAACCACCGTTCTTCTTCTTCTTTCCCTCCCGGTCCTCGCAGCCGCAATTACGATACTATTAACTGACCGTAATTTAAACACAACATTTTTTGATCCTGCAGGGGGAGGAGACCCAATTCTCTACCAACACTTANNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Squalus brevirostris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
White, W.T.

Reviewer/s
Valenti, S.V., Tanaka, S. & Fowler, S.L. (Shark Red List Authority)

Contributor/s

Justification
The Japanese Shortnose Spurdog (Squalus brevirostris) is a dogfish occurring from Southern Japan to the South China Sea including Ryukyu Islands and Vietnam. Japanese Shortnose Spurdog from the northwest Pacific has previously been considered a synonym of the Piked Spurdog (Squalus megalops), however a recent study revealed that this species is clearly separable from the true S. megalops from Australia. Misidentification of Squalus species in the northwest Pacific is an issue and affects the quality of data available. This species is apparently still commonly caught in deepwater demersal fisheries in Japan and Taiwan, Province of China. There is little information currently available and it is probably confused with other Squalus species in the literature. The lack of information precludes an assessment beyond Data Deficient at present and efforts should be made to quantify bycatch and to determine population trends.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Commonly caught in some areas of Japan and Taiwan and appears to be relatively abundant.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Data deficient (DD)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
Caught by bottom trawls and longlines in some parts of its range. Fisheries off the eastern coast of Taiwan, Province of China have moved into deeper water over the past 20 years, particularly around Ta-Shi, from 100?300 m fishing depth to >300 m currently (D. Ebert pers. comm. 2007).

Squlaus species are recorded in catches off Vietnam (SEAFDEC 2006) but nothing is known of the amount of this species taken or the level and impact of fisheries on this species. For example, bottom longline fisheries operate around the Paracel islands, Vietnam at depths >100 m. Sharks account for 45?100% of the total catch with 400?4,000 kg captured per boat (N. long pers. comm. 2007), however, no species specific information is available. In southern Vietnam, off Phu Quy island only about a 100 boats are still targeting sharks due to a general decline in the level of shark catch (N. long pers. comm. 2007), however no data are available to confirm which species have been impacted. In this area fishing boats have switched to targeting snapper and grouper or cuttlefish and squid (N. long pers. comm. 2007).

Other Squalus species in the northwest and Western Central Pacific are targeted and valuable for their liver oil, however, because of species misidentification and confusion no specific information on the utilization of this species is currently available.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
None in place. Efforts should be made to collect species specific catch data. Future surveys should aim to further define this species? distribution and identify population trends.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!