Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Seriola dumerili (Risso, 1810)

Aegean Sea : 13800-261 (1 spc.), 27.11.1990 , Bodrum , N. Meriç .

  • Nurettin Meriç, Lütfiye Eryilmaz, Müfit Özulug (2007): A catalogue of the fishes held in the Istanbul University, Science Faculty, Hydrobiology Museum. Zootaxa 1472, 29-54: 45-45, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:428F3980-C1B8-45FF-812E-0F4847AF6786
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Found in deep seaward reefs; occasionally entering coastal bays. Feed primarily on fishes such as the bigeye scad, also feeds on invertebrates (Ref. 4233). Small juveniles associate with floating plants or debris in oceanic and offshore waters. Juveniles form small schools or solitary (Ref. 5213). Eggs are pelagic (Ref. 4233). Utilized fresh and frozen; eaten pan-fried, broiled and baked (Ref. 9987). Reported to cause ciguatera in some areas (Ref. 26938).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Greater Amberjack (Seriola dumerili) is a member of the Jack family, which consists of typically large, fast-swimming fishes of tropical and warm-temperate seas, occurring from coastal bays and lagoons to open ocean (Robins and Ray 1986).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

The Greater Amberjack has a nearly worldwide distribution in warm waters; in the western Atlantic, it is found from Massachusetts (U.S.A.) to southeastern Brazil (Robins and Ray 1986).

The Greater Amberjack is widely distributed in the Mediterranean, Atlantic and Western Pacific (Porta et al. 2009).

The Greater Amberjack is widely distributed in the Atlantic, Pacific, and Indian Oceans (Harris et al. 2007).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Western Atlantic: Bermuda, Nova Scotia, Canada to Brazil; also from the Gulf of Mexico and the Caribbean Sea
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Circumglobal. Indo-West Pacific: South Africa, Persian Gulf, southern Japan and the Hawaiian Islands, south to New Caledonia; Mariana and Caroline islands in Micronesia. Western Atlantic: Bermuda (Ref. 26938), Nova Scotia, Canada to Brazil; also from the Gulf of Mexico and the Caribbean Sea (Ref. 9626). Eastern Atlantic: British coast (vagrant) to Morocco and the Mediterranean. Distribution in eastern central Atlantic along the African coast is not well established due to past confusion with Seriola carpenteri (Ref. 7097).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Nearly circumglobal in tropical through warm temperate seas (including Mediterranean Sea, Red Sea, Hawaiian Islands), but not in eastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 8; Dorsal soft rays (total): 29 - 35; Analspines: 3; Analsoft rays: 18 - 22
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Greater Amberjack is mostly brownish (darker above, whitish below), often with a broad, diffuse, yellowish stripe along the midside. A dark olive-brown stripe extends from the snout through the eye to the point where the spinous dorsal fin begins. The spinous dorsal fin is low, but easily seen at all sizes (usually with 7 spines). The front lobe of the soft dorsal and anal fins is not very high; the outer edge is curved, but not sickle-shaped. The head is bluntly pointed. There is a fleshy keel on each side of the causal peduncle. There are no detached finlets. (Robins and Ray 1986)

The maxilla (the rear bone of the upper jaw) is very broad posteriorly (i.e., toward the rear) reaching the middle of the eye. The pectoral fins are shorter than the head, equalling the pelvic fins. The second dorsal fin is much longer than the anal fin. The caudal peduncle is relatively deep, with grooves present above and below at the base of the caudal fin. (Boschung et al. 1983)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 1900 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

190 cm TL (male/unsexed; (Ref. 3397)); max. published weight: 80.6 kg (Ref. 3287)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Greater Amberjack may reach 1.5 meters and 80 kg (Robins and Ray 1986).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Inhabits deep seaward reefs occasionally entering coastal bays. Feeds primarily on fishes such as the bigeye scad, also feeds on invertebrates (Ref. 4233). Small juveniles associate with floating plants or debris in oceanic and offshore waters. Juveniles form small schools or solitary (Ref. 5213). Distribution in eastern central Atlantic along the African coast is not well established due to past confusion with @S. carpenteri@ (Ref. 7097). The species is rarely exotic (Ref. 637). Flesh is edible (Ref. 5521). Utilized fresh and frozen; eaten pan-fried, broiled and baked (Ref. 9987).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Bluish grey or olivaceous above, silvery white below; amber stripe along midside of body; fins dusky (Ref. 3197). Second dorsal and anal fins with low anterior lobe (Ref. 26938). Species of Seriola lack scutes (Ref. 37816).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Inhabits deep seaward reefs; occasionally entering coastal bays.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

nektonic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; oceanodromous (Ref. 51243); marine; depth range 1 - 360 m (Ref. 11441), usually 18 - 72 m (Ref. 9626)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 157 specimens in 1 taxon.
Water temperature and chemistry ranges based on 86 samples.

Environmental ranges
  Depth range (m): 0 - 80000
  Temperature range (°C): 3.154 - 26.770
  Nitrate (umol/L): 0.218 - 25.373
  Salinity (PPS): 32.865 - 37.289
  Oxygen (ml/l): 2.699 - 6.300
  Phosphate (umol/l): 0.092 - 1.586
  Silicate (umol/l): 0.921 - 25.365

Graphical representation

Depth range (m): 0 - 80000

Temperature range (°C): 3.154 - 26.770

Nitrate (umol/L): 0.218 - 25.373

Salinity (PPS): 32.865 - 37.289

Oxygen (ml/l): 2.699 - 6.300

Phosphate (umol/l): 0.092 - 1.586

Silicate (umol/l): 0.921 - 25.365
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Greater Amberjack is found in the open sea to 200 fathoms; small specimens occur in shallow water (Boschung et al. 1983).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 350m.
Recorded at 350 meters.

Habitat: reef-associated. Greater yellowtail.  Risso, 1810 Attains 190 cm. and 80 kg. Common to 100 cm. Adults usually in 20-70 metres, often on reefs or at deep offshore holes, in small or moderate schools or solitary. Feeds mainly on fish. Largest among congeners and is considered promising for the aqua-culture industry in Japan. Juveniles are known to follow floating seaweeds. Distributed in warm waters worldwide. Persian Gulf to Algoa Bay; Japan, Australia and Hawaiian Islands. PA
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Pelagic species which occur in inshore waters of the continental shelf and continental slope (Ref. 75154). Found in deep seaward reefs; occasionally entering coastal bays. Feed primarily on fishes such as the bigeye scad, also feeds on invertebrates (Ref. 4233). Small juveniles associate with floating plants or debris in oceanic and offshore waters. Piscivorous predator; males feed more intensely on demersal preys than females (Ref. 41870).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Parrish et al. (2008) used CRITTERCAMS fitted on Hawaiian Monk Seals to study interactions during foraging between the seals and large predatory fish, including the Greater Amberjack. Greater Amberjacks are quick and more agile than the seals, but showed much less ability to detect and flush benthic prey from cover. The seals use their whiskers to brush along the bottom and chase out camouflaged prey. They can also dig out wrasses and eels that are buried deep in the sand bottom and they easily flip large rocks (~20 kg) to obtain prey items hiding beneath. The jacks’ awareness of such behavior enables them to swim ahead of the seal and wait near a rock until the seal arrives and moves the rock, flushing prey items from cover. Parrish et al. found that the jacks routinely positioned their mouths within inches of the seal’s nose to maximize their chances of snatching prey items flushed by the bottom-probing of the seal. On numerous occasions they were observed capturing prey before the seal could catch it.

Andaloro and Pipitone (1997) studied the stomach contents of 308 adult Greater Amberjack in the Mediterranean Sea. They found that fish occurred in 79.7% of non-empty stomachs, accounting for 79.5% of prey in number and 71.0% in weight; cephalopods occurred in 26.8% of non-empty stomachs, accounting for 20.5% of prey in number and 29.0% in weight. Overall, pelagic prey items were less frequent than demersal (dwelling near the sea bottom) ones; moreover, males fed much more intensely on demersal prey than did females.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Paradeontacylix Infection. Parasitic infestations (protozoa, worms, etc.)
  • Leong, T.S. 1992 Diseases of brackishwater and marine fish cultured in some Asian countries. p. 223-236. In M. Shariff, R.P. Subasinghe and J.R. Arthur (eds.) Proceedings of the First Symposium on Diseases in Asian Aquaculture. Asian Fisheries Society, Manila, Philippines. (Ref. 48652)   http://www.fishbase.org/references/FBRefSummary.php?id=48652&speccode=80 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Epitheliocystis. Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Feeds primarily on fishes such as the bigeye scad, also feeds on invertebrates
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Behaviour

In laboratory experiments, Greater Amberjacks were strictly diurnal feeders and this circadian pattern is apparently driven by a strong endogenous clock, with the pattern persisting for many weeks even under conditions of constant light (Chen et al. 2007).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Spawning happens during the summer, in areas near the coast. Embryo development lasts about 40 hours at 23° and larval development 31-36 days. Egg size 1.9 mm, larval at hatching 2.9 mm.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

In a study of Greater Amberjacks in the southeastern United States (Manooch and Potts 1997), the oldest individual examined was 17 years old. In another study, in the north-central Gulf of Mexico, maximum age was estimated to be 15 years (Thompson et al. 1999). In a study of nearly 2000 specimens collected from North Carolina to the Florida Keys, age estimates ranged from 1 to 13 years (Harris et al. 2007).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Based on an examination of about 2500 Greater Amberjack collected from North Carolina to the Florida Keys, Harris et al. (2007) estimated potential fecundity at 18,271,400 to 59,032,800 oocytes for 930 to 1,296 mm specimens and from 25,472,100 to 47,194,300 oocytes for ages 3 to 7. Peak spawning off south Florida and the Florida Keys occurred during April and May.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Genetics

Renshaw et al. (2007) developed microsatellite markers for the Greater Amberjack with the hope that they would be useful for conservation and population genetic studies of both wild and "domesticated" stocks of this fish.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology

Statistics of barcoding coverage: Seriola dumerili

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 38
Specimens with Barcodes: 61
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Seriola dumerili

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAGTATTTGGTGCCTGAGCCGGCATGGTCGGTACAGCCTTAAGTTTACTCATCCGAGCAGAACTAAGCCAACCCGGGGCTCTCCTGGGAGACGATCAAATTTACAACGTAATCGTTACAGCACACGCGTTTGTAATAATTTTCTTTATAGTAATGCCAATTATGATTGGAGGATTTGGGAACTGACTCATCCCTTTAATGATTGGAGCTCCCGATATAGCATTCCCTCGAATGAATAATATGAGCTTCTGACTCCTCCCTCCTTCATTCCTTCTACTCCTAGCCTCTTCGGGTGTTGAAGCCGGAGCCGGGACAGGTTGGACAGTTTACCCGCCTCTGGCCGGCAACCTCGCCCACGCAGGAGCATCCGTAGACTTAACAATTTTCTCCCTTCACTTAGCTGGGATCTCCTCAATTCTAGGAGCTATTAACTTCATCACAACCATCGTCAATATGAAACCCCACGCCGTTTCCATGTACCAAATTCCCCTGTTTGTCTGAGCTGTCCTTATCACGGCTGTACTCCTACTCCTATCACTTCCAGTCCTAGCCGCCGGTATTACAATGCTTCTTACAGACCGAAACTTAAACACTGCCTTCTTTGACCCAGCTGGAGGAGGGGATCCCATCCTTTACCAACACCTGTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

The Greater Amberjack is currently listed by the National Marine Fisheries Service as overfished in the Gulf of Mexico (NMFS 2008, Federal Register, 73 FR 16829-16830).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquaculture: commercial; gamefish: yes; aquarium: public aquariums; price category: high; price reliability: reliable: based on ex-vessel price for this species
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Uses

The Greater Amberjack is an important game fish (Robins and Ray 1986).

The Greater Amberjack is of high commercial value in worldwide fisheries. The interest in this species in aquaculture is increasing due to its fast growth, low mortality, and good performance, having now been cultured successfully in Japan for some years, as well as in the Mediterranean and Atlantic. (Porta et al. 2009 and references therein)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

Risk Statement

The flesh of the Greater Amberjack can cause ciguatera poisoning (Robins and Ray 1986; Poli et al. 1997) if it has fed on other fishes that have been contaminated with toxins produced by certain dinoflagellate algae, notably Gambierdiscus toxicus.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Greater amberjack

Greater amberjack

The greater amberjack (Seriola dumerili) is a jack of the genus Seriola. It is found in the Mediterranean Sea, the Atlantic Ocean, the Pacific Ocean and the Indian coasts, living usually between 20 and 70 m of depth (with a maximum of 360 m). It is the largest genus in the Carangidae family, with a maximum length of 200 cm. It is a fast-swimming pelagic fish with similar habits to the kingfish. They are silver-blue with a golden side line, with a brown band crossing over the eye area.

The greater amberjack is a powerful hunter which feeds on other fish and invertebrates.

The greater amberjack is prized by sports fisherman because it is a very powerful fish and can be quite large, even as much as 70 kg. It is an excellent eating fish. It is also a big-game fish and are one of the greatest fighting fish pound for pound.[citation needed]

References[edit]

  • Froese, Rainer and Pauly, Daniel, eds. (2008). "Seriola dumerili" in FishBase. January 2008 version.
  • Louisy, Patrick (2006). Guida all'identificazione dei pesci marini d'Europa e del Mediterraneo. Milan: Il Castello. ISBN 88-8039-472-X. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!