Overview

Brief Summary

The Lookdown (Selene vomer) has an extremely deep and laterally compressed body with very small, embedded scales. The overall color is iridescent silvery to golden, with a metallic bluish tinge on the dorsal (top) surface. The dorsal ("back") and ventral ("belly") profiles are straight anteriorly (i.e., toward the front) and nearly parallel. The front profile of the head is very steep, with a mouth near the bottom. On each side of the body, the lateral line is arched upward anteriorly.

In adults, the pelvic fins (the anteriormost fins toward the underside of the fish) are very short. The first dorsal fin (on the fish's back) has eight spines, which are persistent. The second dorsal fin and the anal fin are long and falcate (sickle-shaped). The anal fin consists of two free spines followed by one spine and 17-20 rays, with the anterior rays elongated and forming an acute lobe. The two free anal spines are resorbed as the fish grows. Free anal fins are absent in individuals greater than 11 cm FL. ("Forklength" [FL] is the length from the tip of the snout to the end of the middle caudal [tail] fin rays; this length measure is used for fish species in which it is difficult to determine where the vertebral column ends and the tail fin begins, as is necessary for the more common "standard length" [SL].) Unlike adults, young fish have long pelvic fins and long streamerlike flaments extending from the first dorsal spines. In adults, the second dorsal and anal fins are greatly extended. This transition is complete by the time the fish reaches 10 to 12.5 cm. Juveniles also have a dusky, slightly oblique crossband and band over the eye. See McEachran and Fechhelm (2005) for a more detailed morphological description.

Lookdowns occur in shallow coastal waters over sand or mud in the western Atlantic from Maine to Uruguay, including Bermuda; in the northern and southern Gulf of Mexico; and in the Greater Antilles. They travel in schools and feed near the bottom on crustaceans and other fishes. Maximum known size is 40 cm FL.

(Boschung et al. 1983; Robins and Ray 1996; McEachran and Fechhelm 2005)

  • Boschung, H.T., Jr., Williams, J.D., Gotshall, D.W., Caldwell, D.K., and M.C. Caldwell. 1983. The Audubon Society Field Guide to North American Fishes, Whales, and Dolphins. Alfred A. Knopf, New York.
  • McEachran, J.D. and J.D. Fechhelm. 2005. Fishes of the Gulf of Mexico, Vol. 2. Scorpaeniformes to Tetraodontiformes. University of Texas Press, Austin.
  • Robins, C.R. and G.C. Ray. 1986. A Field Guide to Atlantic Coast Fishes of North America. Houghton Mifflin, Boston.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Leo Shapiro

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Found in shallow coastal waters, usually over hard or sandy bottoms. Juveniles may be encountered in estuarine areas (Ref. 9626) and off sandy beaches (Ref. 5217). Found in schools, but may be encountered in small groups or in pairs (Ref. 26235). Feeds on small crabs, shrimps, fishes, and worms. Flesh has excellent flavor (Ref. 5521). Marketed fresh (Ref. 9710).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Atlantic: from Maine to Florida, USA (possibly from Nova Scotia, Canada), along coasts of central and south America to Uruguay, including Bermuda and Gulf of Mexico. Rare in Greater Antilles
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Warm waters on the east and west coasts of America, north rarely to Cape Cod, straying to the Gulf of Maine and to Nova Scotia; common from Chesapeake Bay southward.
  • Bigelow, H.B. and W.C. Schroeder, 1953; Cervigón, F., 1993; Coupal, L., E. B?rd, C. Peguero and I.S. Durante, 1992; Robins, C.R. and G.C. Ray, 1986; Whiteheat, P.J.P., M.-L. Bauchot, J.-C. Hureau, J. Nielsen, and E. Tortonese, 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: Canada (Ref. 5951) to Maine to Florida, USA (possibly from Nova Scotia, Canada), along coasts of central and south America (Ref. 26938) to Uruguay, including Bermuda and Gulf of Mexico (Ref. 9626). Rare in Greater Antilles (Ref. 26938).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gulf of Maine, Gulf of Mexico, North West Atlantic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 23; Analspines: 3; Analsoft rays: 18
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 483 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

48.3 cm TL (male/unsexed; (Ref. 9626)); max. published weight: 2,100 g (Ref. 40637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

to 48.3 cm TL (male/unsexed); max. weight: 1,670.0 g.
  • Bigelow, H.B. and W.C. Schroeder, 1953; Cervigón, F., 1993; Coupal, L., E. B?rd, C. Peguero and I.S. Durante, 1992; Robins, C.R. and G.C. Ray, 1986; Whiteheat, P.J.P., M.-L. Bauchot, J.-C. Hureau, J. Nielsen, and E. Tortonese, 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Pelvic fin small.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth: 1 - 53m.
From 1 to 53 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; brackish; marine; depth range 1 - 53 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

benthic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Found in shallow coastal waters, usually over hard or sandy bottoms.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 483 specimens in 1 taxon.
Water temperature and chemistry ranges based on 122 samples.

Environmental ranges
  Depth range (m): 0 - 320.5
  Temperature range (°C): 7.337 - 27.601
  Nitrate (umol/L): 0.286 - 20.244
  Salinity (PPS): 32.507 - 36.424
  Oxygen (ml/l): 3.453 - 6.494
  Phosphate (umol/l): 0.006 - 1.352
  Silicate (umol/l): 0.756 - 14.136

Graphical representation

Depth range (m): 0 - 320.5

Temperature range (°C): 7.337 - 27.601

Nitrate (umol/L): 0.286 - 20.244

Salinity (PPS): 32.507 - 36.424

Oxygen (ml/l): 3.453 - 6.494

Phosphate (umol/l): 0.006 - 1.352

Silicate (umol/l): 0.756 - 14.136
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Demersal; brackish; marine; depth range 1 - 53 m. In shallow coastal waters, over hard or sand bottoms, often in schools but may be in small groups or in pairs. Juveniles can occur in estuaries and off sandy beaches.
  • Bigelow, H.B. and W.C. Schroeder, 1953; Cervigón, F., 1993; Coupal, L., E. B?rd, C. Peguero and I.S. Durante, 1992; Robins, C.R. and G.C. Ray, 1986; Whiteheat, P.J.P., M.-L. Bauchot, J.-C. Hureau, J. Nielsen, and E. Tortonese, 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Found in shallow coastal waters, usually over hard or sandy bottoms. Juveniles may be encountered in estuarine areas (Ref. 9626) and off sandy beaches (Ref. 5217). Feeds on small crabs, shrimps, fishes, and worms and other benthic crustaceans (Ref. 26338).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Small crabs, shrimps, fishes, and polychaetes.
  • Bigelow, H.B. and W.C. Schroeder, 1953; Cervigón, F., 1993; Coupal, L., E. B?rd, C. Peguero and I.S. Durante, 1992; Robins, C.R. and G.C. Ray, 1986; Whiteheat, P.J.P., M.-L. Bauchot, J.-C. Hureau, J. Nielsen, and E. Tortonese, 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Pseudohurleytrema Infestation 1. Parasitic infestations (protozoa, worms, etc.)
  • Nahhas, F.M. and A. Grewal 1999 Digenetic trematodes from marine fishes of Fiji: Subfamily Hurleytrematinae (family Monorchiidae): A review and description of four new species of Hurleytrematoides. p.617-631. In Séret B. and J.-Y. Sire (eds.) Proc. 5th Indo-Pac. Fish Conf., Nouméa, 1997. Paris: Soc. Fr. Ichtyol. (Ref. 48836)   http://www.fishbase.org/references/FBRefSummary.php?id=48836&speccode=380 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Spawns in the summer and has pelagic eggs.
  • Bigelow, H.B. and W.C. Schroeder, 1953; Cervigón, F., 1993; Coupal, L., E. B?rd, C. Peguero and I.S. Durante, 1992; Robins, C.R. and G.C. Ray, 1986; Whiteheat, P.J.P., M.-L. Bauchot, J.-C. Hureau, J. Nielsen, and E. Tortonese, 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Selene vomer

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTAGTATTTGGTGCTTGAGCCGGAATGGTAGGAACAGCTTTAAGCCTACTTATTCGAGCAGAACTAAGCCAACCCGGCGCCCTTCTAGGAGACGACCAAATTTACAACGTTATCGTTACGGCCCACGCCTTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGCTTCGGAAACTGACTCATCCCACTAATGATCGGGGCCCCTGATATGGCATTCCCCCGAATGAACAATATGAGCTTCTGACTTCTCCCTCCCTCCTTCCTCTTACTCTTAGCCTCTTCAGGAGTTGAGGCTGGGGCTGGGACTGGATGAACAGTATACCCTCCGTTAGCTGGAAACCTCGCCCACGCTGGAGCATCAGTTGATCTAACCATTTTCTCTCTTCATCTCGCAGGGGTTTCATCAATCCTAGGCGCTATTAATTTTATTACCACTATTATTAACATGAAGCCTCCTGCGGTTTCAATGTACCAAATTCCACTATTTGTGTGAGCTGTCTTAATTACAGCAGTCCTACTCCTTCTTTCCCTGCCAGTTCTAGCCGCTGGCATTACGATGCTCCTAACGGACCGAAATCTAAACACTGCTTTCTTCGACCCAGCAGGAGGGGGCGATCCTATCCTTTATCAACACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Selene vomer

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 25
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; gamefish: yes; aquarium: public aquariums; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Lookdown

The lookdown, Selene vomer, is a game fish of the Carangidae family. The lookdown was first described in 1758 by the "father of taxonomy", Carolus Linnaeus, in the 10th edition of his book Systema Naturae.

Contents

Description

Although the lookdown is similar to the Atlantic moonfish, it can be distinguished by its dorsal and anal fins, the second ray on each fin being many times longer than the surrounding rays. This gives the dorsal and anal fins a noticeably scythe-like shape.[1] Also, the dorsal fin of the lookdown has 9 spines and 23 rays, while the anal fin has only 3 spines and 18 rays.[2] The lookdown, like the Atlantic moonfish, had a deep, rhombus-shaped, laterally-compressed body.[1] The head has the mouth set low and the eyes high. The overall profile of a lookdown's head is concave.[1] The caudal fin of the lookdown is forked, as in the Pompanos, while the pectoral fin is similar to a scythe and reaches the middle of the second of the lookdown's dorsal fin.[1]

Lookdown are usually described as being silvery on both sides with darker tints on top. Young lookdown have several faint, vertical bars that fade as the fish grows.[3] The longest lookdown known was 48.3 cm long,[4] the heaviest known lookdown weighed 2.1 kg.[5]

Distribution and habitat

Selene vomer at the Musée Océanographique of Monaco

In the western Atlantic, the lookdown is found from Canada[6] and Maine south to Uruguay,[7] which includes Bermuda and the Gulf of Mexico.[8] Although lookdown are common in tropical, Atlantic waters, they are rarely seen in the Greater Antilles.[7]

Lookdown are found in both marine and brackish waters at depths of 1 to 53 meters.[1] They usually live in shallow water near the coast, along hard or sandy bottoms.[9] Juveniles may be seen in estuaries[4] or near sandy beaches[10] Lookdown usually swim together in shoals, but they often break away into smaller groups or even in pairs.[11]

Commercial Importance

Lookdown do not play a significant role in commercial fisheries. However, lookdown are highly sought after for large public aquarium displays due to their interesting shape and flashy appearance. Proaquatix raises the only known captive bred lookdowns strictly as an ornamental species.

References

  1. ^ a b c d e "gma.org entry on Lookdown". Retrieved 2008-05-01. 
  2. ^ "Fishbase.org entry on Lookdown". Retrieved 2008-05-02. 
  3. ^ "gma.org entry on Lookdown". Retrieved 2008-05-03. 
  4. ^ a b Cervigón, F., 1993. Los peces marinos de Venezuela. Volume 2. Fundación Científica Los Roques, Caracas,Venezuela. 497 p.
  5. ^ IGFA, 2001. Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA.
  6. ^ Scott, W.B. and M.G. Scott, 1988. Atlantic fishes of Canada. Can. Bull. Fish. Aquat. Sci. 219: 731 p.
  7. ^ a b Smith, C.L., 1997. National Audubon Society field guide to tropical marine fishes of the Caribbean, the Gulf of Mexico, Florida, the Bahamas, and Bermuda. Alfred A. Knopf, Inc., New York. 720 p.
  8. ^ Cervigón, F., 1993. Los peces marinos de Venezuela. Volume 2. Fundación Científica Los Roques, Caracas,Venezuela. 497 p. Paper URL:
  9. ^ "Fishbase.org entry on Lookdown". Retrieved 2008-04-29. 
  10. ^ Cervigón, F., R. Cipriani, W. Fischer, L. Garibaldi, M. Hendrickx, A.J. Lemus, R. Márquez, J.M. Poutiers, G. Robaina and B. Rodriguez, 1992. Fichas FAO de identificación de especies para los fines de la pesca. Guía de campo de las especies comerciales marinas y de aquas salobres de la costa septentrional de Sur América. FAO, Rome. 513 p. Preparado con el financiamento de la Comisión de Comunidades Europeas y de NORAD.
  11. ^ Coupal, L., E. Bédard, C. Peguero and I.S. Durante, 1992. Repertorio ictionímici de la República Dominicana. Fáscículo I : AcanthuridaeCarangidae. LIRD.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!