Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Comprehensive Description

Biology

Adults are found in shallow coastal waters in small schools near the bottom (Ref. 9283). They feed on small squids, shrimps, polychaetes and small fishes (Ref. 9283). Marketed fresh and salted (Ref. 9283).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

  Common names: lookdown (English), jorobado (Espanol), palometa (Espanol)
 
Selene brevoortii (Gill, 1863)


Pacific lookdown,     Mexican lookdown



Body pentagonal shape and strongly compressed; head very deep with angular nape and very steep concave forehead-snout profile; lower gill rakers (excluding rudiments) 29-34; dorsal rays VIII+I, 20-24, spines of dorsal fin short, with at least last one isolated; anal rays II+I, 17-18; dorsal and anal fin spines become embedded with age;  dorsal and anal fin lobes prolonged in adults; in juveniles front dorsal spines extremely elongate and filamentous, front anal spines not elongate; pelvic fins elongate in small juveniles, becoming very short in adults; no isolated finlets after 2nd  dorsal and anal fins; pectoral long, curved; straight part of lateral line with poorly developed, small scutes (hard spiny scales); scales very small, imbedded in skin, body appears scaleless.


Overall silvery in color.

Size: reaches 42 cm.

Habitat: demersal on sandy bottoms.

Depth: 1-50 m.

Southern California to the lower half of the Gulf of California to Chile.
   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This eastern Pacific species is found from southern California to the lower half of the Gulf of California to Chile, and Malpelo Island.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, East Pacific endemic, Tropical Eastern Pacific (TEP) endemic

Regional Endemism: All species, TEP endemic, Continental TEP endemic, 3 provinces (Cortez + Mexican + Panamic) endemic, Continent

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo), South Temperate (Peruvian Province )
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific: southern tip of Baja California, Mexico to Ecuador.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth

Depth Range (m): 1 (G) - 50 (G)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Size

Length max (cm): 42.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 380 mm FL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

38.0 cm FL (male/unsexed; (Ref. 9283))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Body short, deep, and strongly compressed; lower branch of first gill arch with 29 to 34 gill rakers; dorsal fin with 8 spines followed by another spine and 20 to 23 soft rays (VIII+1,20-23); anterior lobes of second dorsal and anal fins very long in adults; anterior dorsal spines greatly prolonged in juveniles; body scaleless; lateral line scutes very weak and poorly differentiated; body golden or silvery with metallic blue highlights; juveniles yellowish, with indistinct, interrupted, dark, transverse bars (Ref. 55763).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Holotype for Argyriosus brevoortii
Catalog Number: USNM 4438
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Xantus
Locality: Lower California, Cape San Lucas., Baja California Sur, Mexico, Pacific
  • Holotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This is a benthopelagic and demersal species found in shallow coastal waters. It is found in small schools near the bottom. It feeds on small squids, shrimps, polychaetes and small fishes (Smith-Vaniz 1995). This species is found at depths to 50 m.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

benthopelagic; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 37 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 1 - 53
  Temperature range (°C): 25.094 - 25.936
  Nitrate (umol/L): 1.905 - 2.596
  Salinity (PPS): 33.041 - 33.457
  Oxygen (ml/l): 4.037 - 4.252
  Phosphate (umol/l): 0.364 - 0.462
  Silicate (umol/l): 3.320 - 4.557

Graphical representation

Depth range (m): 1 - 53

Temperature range (°C): 25.094 - 25.936

Nitrate (umol/L): 1.905 - 2.596

Salinity (PPS): 33.041 - 33.457

Oxygen (ml/l): 4.037 - 4.252

Phosphate (umol/l): 0.364 - 0.462

Silicate (umol/l): 3.320 - 4.557
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Salinity: Marine, Brackish, Freshwater

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Near Bottom, Bottom, Bottom + water column

Habitat: Soft bottom (mud, sand,gravel, beach, estuary & mangrove), Soft bottom only, Sand & gravel, Beach, Estuary

FishBase Habitat: Bentho-Pelagic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

A pelagic and demersal species found in shallow coastal waters. Found in small schools near the bottom. Feeds on small squids, shrimps, polychaetes and small fishes.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: mobile benthic worms, mobile benthic crustacea (shrimps/crabs), octopus/squid/cuttlefish, bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Hurleytrematoides Infestation 5. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Selene brevoortii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTAGTATTTGGTGCTTGAGCCGGAATGGTAGGAACAGCTTTAAGCCTACTTATTCGAGCAGAACTAAGCCAACCTGGCGCCCTTCTAGGAGACGACCAAATTTACAACGTTATCGTTACGGCCCACGCCTTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGTTTCGGAAACTGACTCATCCCACTAATGATCGGAGCCCCCGACATGGCATTCCCCCGAATGAACAATATGAGCTTTTGACTTCTCCCTCCCTCCTTCCTCCTACTCTTAGCCTCTTCAGGAGTTGAAGCCGGAGCTGGGACTGGTTGGACAGTGTACCCTCCATTAGCTGGGAATCTCGCCCACGCCGGAGCATCAGTCGATTTAACCATTTTCTCTCTTCATCTAGCAGGGGTTTCGTCAATCCTAGGCGCTATTAATTTTATTACCACTATTATTAACATGAAACCTCCTGCGGTTTCAATGTACCAAATCCCACTATTTGTGTGAGCTGTCTTAATTACAGCTGTCCTACTCCTTCTCTCCCTGCCAGTCCTGGCCGCCGGCATTACGATACTCCTGACGGACCGAAATCTAAACACTGCCTTCTTCGACCCAGCAGGAGGGGGTGACCCTATCCTTTATCAACACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Selene brevoortii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Selene brevoorti

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Smith-Vaniz, B, Robertson, R., Dominici-Arosemena, A. & Molina, H.

Reviewer/s
Carpenter, K., Polidoro, B. & Livingstone, S. (Global Marine Species Assessment Team)

Contributor/s

Justification
This species is widespread in the tropical eastern Pacific. There are no major threats to this species, and no current indication of widespread population decline. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
There is no population information available for this species.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats known for this species.
This species is caught in artisanal fisheries using gill nets. This species is an important commercial fish in Golfo de Montijo, Panama (Vega 2004). It is marketed fresh and salted (Smith-Vaniz 1995).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no known species specific conservation measures. However, this species' distribution includes a number of Marine Protected Areas in the tropical eastern Pacific region.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; gamefish: yes; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
  • Coppola, S.R., W. Fischer, L. Garibaldi, N. Scialabba and K.E. Carpenter 1994 SPECIESDAB: Global species database for fishery purposes. User's manual. FAO Computerized Information Series (Fisheries). No. 9. Rome, FAO. 103 p. (Ref. 171)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Airfin lookdown

Selene brevoortii (the airfin lookdown, hairfin lookdown, Mexican lookdown, or Pacific lookdown),[1] is a species of carangid native to the Pacific coast of the Americas where it is found from southernmost Baja California, Mexico to Ecuador. This species is generally found in shallow waters close to the coast. They grow to 42 cm (17 in) in total length. It is of minor importance to local commercial fisheries, but is popular as a gamefish.[2]

References[edit]

  1. ^ "Selene brevoorti". Polistes Foundation. Retrieved 11 August 2013. 
  2. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Selene brevoortii" in FishBase. February 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!