Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Adults are found close to bottom while juveniles occur in mid water (Ref. 4952). Feed on small mollusks and crustaceans (Ref. 5288). Not regularly marketed (Ref. 5217).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Worldwide in subtropical and tropical oceans. Eastern Atlantic: France to Namibia, including Azores and Madeira. Western Atlantic: southern New England, USA and Gulf of Mexico to [Brazil according to Ref. 7251] Uruguay (Ref. 47377). Pacific Ocean: Hawaii (Ref. 7490), Japan (Ref. 559) and Nazca and Sala-y-Gomez (Ref. 50546).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Western Atlantic: southern New England, USA and Gulf of Mexico to Brazil
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Circumglobal in tropical through warm temperate seas, including western Mascarenes and Hawaiian Islands, but except Eastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Tropical and subtropical Atlantic, mostly offshore.
  • Bigelow, H.B. and Schroeder,W.C., 1953; Karrer, C. and A. Post, 1990; Qu?, J.-C., 1986; Edwards, A., 1990; Whiteheat, P.J.P., Bauchot, M.-L., Hureau, J.-C., Nielsen, J., Tortonese, E., 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 8 - 9; Dorsal soft rays (total): 337; Analspines: 3; Analsoft rays: 30 - 35
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 305 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

30.5 cm TL (male/unsexed; (Ref. 26340)); max. published weight: 170 g (Ref. 5217)
  • Claro, R. 1994 Características generales de la ictiofauna. p. 55-70. In R. Claro (ed.) Ecología de los peces marinos de Cuba. Instituto de Oceanología Academia de Ciencias de Cuba and Centro de Investigaciones de Quintana Roo. (Ref. 26340)   http://www.fishbase.org/references/FBRefSummary.php?id=26340&speccode=14 External link.
  • Cervigón, F., R. Cipriani, W. Fischer, L. Garibaldi, M. Hendrickx, A.J. Lemus, R. Márquez, J.M. Poutiers, G. Robaina and B. Rodriguez 1992 Fichas FAO de identificación de especies para los fines de la pesca. Guía de campo de las especies comerciales marinas y de aquas salobres de la costa septentrional de Sur América. FAO, Rome. 513 p. Preparado con el financiamento de la Comisión de Comunidades Europeas y de NORAD. (Ref. 5217)   http://www.fishbase.org/references/FBRefSummary.php?id=5217&speccode=7 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

to 30.5 cm TL (male/unsexed); max.weight: 170.0 g.
  • Bigelow, H.B. and Schroeder,W.C., 1953; Karrer, C. and A. Post, 1990; Qu?, J.-C., 1986; Edwards, A., 1990; Whiteheat, P.J.P., Bauchot, M.-L., Hureau, J.-C., Nielsen, J., Tortonese, E., 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Body orange red, 3 dark red bands on eye, mid-body and caudal peduncle (Ref. 13608). Mouth oblique; longest dorsal spine about 1/4 of SL (Ref. 559).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

benthic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Found at depths of 50-900m.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; marine; depth range 50 - 900 m (Ref. 5217), usually 100 - 300 m (Ref. 4952)
  • Cervigón, F., R. Cipriani, W. Fischer, L. Garibaldi, M. Hendrickx, A.J. Lemus, R. Márquez, J.M. Poutiers, G. Robaina and B. Rodriguez 1992 Fichas FAO de identificación de especies para los fines de la pesca. Guía de campo de las especies comerciales marinas y de aquas salobres de la costa septentrional de Sur América. FAO, Rome. 513 p. Preparado con el financiamento de la Comisión de Comunidades Europeas y de NORAD. (Ref. 5217)   http://www.fishbase.org/references/FBRefSummary.php?id=5217&speccode=7 External link.
  • Quéro, J.-C. 1986 Caproidae. p. 777-779. In P.J.P. Whitehead, M.-L. Bauchot, J.-C. Hureau, J. Nielsen and E. Tortonese (eds.) Fishes of the north-eastern Atlantic and the Mediterranean. UNESCO, Paris. Vol. 2. (Ref. 4952)   http://www.fishbase.org/references/FBRefSummary.php?id=4952&speccode=54 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 461 specimens in 1 taxon.
Water temperature and chemistry ranges based on 331 samples.

Environmental ranges
  Depth range (m): 0 - 50000
  Temperature range (°C): 3.007 - 23.468
  Nitrate (umol/L): 0.434 - 33.780
  Salinity (PPS): 34.274 - 36.604
  Oxygen (ml/l): 2.619 - 5.663
  Phosphate (umol/l): 0.132 - 2.280
  Silicate (umol/l): 1.102 - 53.757

Graphical representation

Depth range (m): 0 - 50000

Temperature range (°C): 3.007 - 23.468

Nitrate (umol/L): 0.434 - 33.780

Salinity (PPS): 34.274 - 36.604

Oxygen (ml/l): 2.619 - 5.663

Phosphate (umol/l): 0.132 - 2.280

Silicate (umol/l): 1.102 - 53.757
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 50 - 900m.
From 50 to 900 meters.

Habitat: demersal. Gregarious. Lives close to the sea bottom. Juveniles occur in mid-water (Ref. 4952). Feeds on small molluscs and crustaceans (Ref. 5288).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Demersal; marine; depth range; 50-900 m. Juveniles occur in mid water.
  • Bigelow, H.B. and Schroeder,W.C., 1953; Karrer, C. and A. Post, 1990; Qu?, J.-C., 1986; Edwards, A., 1990; Whiteheat, P.J.P., Bauchot, M.-L., Hureau, J.-C., Nielsen, J., Tortonese, E., 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Found on continental slope. Benthic species (Ref. 75154). Juveniles occur in mid water. Feed on small molluscs and crustaceans. Also consume hyperiid amphipods, euphausiids and small squid (Ref. 54164).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeds on small molluscs and crustaceans.
  • Bigelow, H.B. and Schroeder,W.C., 1953; Karrer, C. and A. Post, 1990; Qu?, J.-C., 1986; Edwards, A., 1990; Whiteheat, P.J.P., Bauchot, M.-L., Hureau, J.-C., Nielsen, J., Tortonese, E., 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Feeds on small molluscs and crustaceans
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

During summer (tropical parts of eastern Atlantic).
  • Bigelow, H.B. and Schroeder,W.C., 1953; Karrer, C. and A. Post, 1990; Qu?, J.-C., 1986; Edwards, A., 1990; Whiteheat, P.J.P., Bauchot, M.-L., Hureau, J.-C., Nielsen, J., Tortonese, E., 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Antigonia capros

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 27
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Antigonia capros

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACGCTGATTCTTCTCAACTAACCATAAAGATATCGGCACCCTCTATCTAGTATTTGGTGCTTGAGCTGCTATAGTGGGCACAGCCCTAAGCTTACTTATCCGAGCTGAACTAAGCCAACCTGGGGCACTCCTAGGAGAT---GACCAAATCTACAATGTTGTAGTTACAGCACATGCCTTTGTAATAATTTTCTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAACTGACTAATTCCTTTAATGATTGGAGCCCCCGATATAGCATTCCCCCGAATGAACAATATGAGCTTCTGACTACTTCCACCCTCTTTTTTACTTCTCCTTGCCTCTTCTATAGTAGAAGCAGGGGCGGGCACTGGATGAACAGTTTACCCCCCTCTAGCTGGGAACCTGGCCCATGCCGGGGCATCAGTTGACTTAACAATTTTTTCTCTCCACTTAGCAGGGATTTCCTCAATCCTTGGGGCCATCAACTTTATCACAACTATTATTAATATGAAACCTCCCGCTATTTCCCAGTACCAAACTCCCCTGTTTGTTTGAGCAGTACTAATTACTGCAGTTCTTCTTCTCCTCTCCCTTCCCGTCCTTGCTGCCGGAATTACAATACTTCTTACAGACCGAAACTTGAACACCACCTTCTTTGACCCAGCCGGAGGAGGAGACCCGATTCTTTATCAACATCTATTCTGATTTTTTGGGCACCCTGAAGTTTACATCCTGATTCTTCCGGGCTTTGGAATAATTTCTCATATTGTTGCCTACTACTCAGGTAAAAAAGAACCATTCGGCTATATAGGCATAGTTTGAGCCATAATGGCTATTGGACTCTTGGGCTTCATCGTGTGAGCCCATCATATGTTTACTGTAGGAATGGACGTAGACACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: unknown; price reliability:
  • Cervigón, F., R. Cipriani, W. Fischer, L. Garibaldi, M. Hendrickx, A.J. Lemus, R. Márquez, J.M. Poutiers, G. Robaina and B. Rodriguez 1992 Fichas FAO de identificación de especies para los fines de la pesca. Guía de campo de las especies comerciales marinas y de aquas salobres de la costa septentrional de Sur América. FAO, Rome. 513 p. Preparado con el financiamento de la Comisión de Comunidades Europeas y de NORAD. (Ref. 5217)   http://www.fishbase.org/references/FBRefSummary.php?id=5217&speccode=7 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Antigonia capros

The deepbody boarfish, Antigonia capros, is a species of boarfish, the most widespread species in the family, found at depths of 50 to 900 m (160 to 2,950 ft) in the Atlantic, Indian and Pacific Oceans, though it usually is found at depths of 100 to 300 m (330 to 980 ft). This species can reach a length of 30.5 cm (12.0 in), though most do not exceed 15 cm (5.9 in). The heaviest recorded specimen weighed 170 g (0.37 lb). It is of minor importance to commercial fishery operations.[1]

References[edit]

  1. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Antigonia capros" in FishBase. February 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!