Overview

Comprehensive Description

Biology

Young occur singly and commonly found in tide pools. Adults are commonly seen in small groups in midwater or near the surface.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species occurs in the western Indian Ocean where it has been recorded along the East African coast from Delagoa Bay (Mozambique) to Knysna (South Africa). Animals have been reported at depths between 5-30 m (G.R. Allen pers. comm. 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Indian Ocean: Delagoa Bay, Mozambique to Knysna, South Africa.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Indian Ocean.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 11 - 13; Dorsal soft rays (total): 22 - 25; Analspines: 3; Analsoft rays: 21 - 23
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 460 mm ---
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

46.0 cm TL (male/unsexed; (Ref. 10629)); max. published weight: 3,000 g (Ref. 10629)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Associated with rocky reefs and shoreline areas. Juveniles may be encountered in shallow tidal pools. Groups of adults (20 to 30 animals [Endoh 2007]) can occasionally be seen swimming above reefs in mid-water, sometimes coming close to the waters surface when feeding on plankton (G.R. Allen pers. comm. 2006).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 9 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 11 - 257.5
  Temperature range (°C): 24.747 - 24.747
  Nitrate (umol/L): 1.175 - 1.175
  Salinity (PPS): 35.272 - 35.272
  Oxygen (ml/l): 4.844 - 4.844
  Phosphate (umol/l): 0.295 - 0.295
  Silicate (umol/l): 5.266 - 5.266

Graphical representation

Depth range (m): 11 - 257.5
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pomacanthus rhomboides

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATTTACTATTTGGTGCCTGAGCCGGGATGGTGGGCACAGCTTTAAGCCTGCTTATCCGAGCCGAACTAAACCAACCAGGTAGCCTTCTCGGAGACGACCAGATCTACAATGTAATCGTTACAGCACACGCATTTGTAATAATCTTTTTTATAGTTATACCAGCTATAATCGGGGGTTTTGGGAACTGATTGGTCCCACTGATAATTGGGGCCCCAGACATGGCATTCCCCCGAATAAATAATATAAGCTTTTGGCTCTTACCCCCCTCCCTCCTTCTCCTCCTTGCCTCCGCTGGGGTAGAAGCCGGGGCCGGAACTGGATGAACAGTCTACCCGCCCTTAGCCGGCAATCTAGCCCATGCAGGAGCATCCGTAGACCTAACCATTTTCTCTCTCCACCTGGCCGGAATTTCCTCAATTCTTGGGGCTATCAATTTTATTACAACTATTATTAACATAAAACCTCCCGCCATTTCACAATACCAAACCCCACTGTTTGTGTGGGCCGTCCTAATCACTGCAGTATTACTTCTTCTTTCCCTCCCCGTCCTTGCCGCTGGCATTACTATGCTTCTTACAGACCGAAATCTAAACACCACCTTCTTCGACCCTGCAGGAGGCGGGGATCCAATCCTTTACCAACACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pomacanthus rhomboides

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Rocha, L.A., Pyle, R., Myers, R. & Craig, M.T.

Reviewer/s
Elfes, C., Polidoro, B., Livingstone, S. & Carpenter, K.E.

Contributor/s

Justification
It is listed as Least Concern, as this is a common species with a relatively wide range and no apparent major threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
It is generally common with stable populations.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats

There appear to be no major threats to this species. Collection for the aquarium trade is very limited and localized and does not seem to affect the global population.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

There are no species-specific conservation measures in place. Populations are present within some marine protected areas.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Old woman angelfish

A young, immature P. rhomboides

Pomacanthus rhomboides (Old woman angelfish) is a large angelfish growing up to 45cm, found in the western Indian Ocean. Adult P. rhomboides are brown with the back third of the body (closest to the caudal fin) being light blue whilst immature specimens are black with wavering blue and white bands, these specimens can be confused with many other Pomacanthus angelfish because of their very similar coloration. Adults of this species can often be found in small groups feeding at the surface or in midwater whilst immature specimens are usually found singularly in tidal pools.

P.rhomboides is generally not collected for the aquarium trade because of its drab adult colours, and the fact that it is found outside normal fish-collecting areas, it is also fairly rare in nature and shy.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!