Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Inhabits areas of rich coral growth from near shore to the outer reef slope (Ref. 4313). Benthic (Ref. 58302). Cryptic. Venomous spines (Ref. 4313). Minimum depth reported taken from Ref. 30874.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-Pacific: Red Sea to the Marquesan and Tuamoto islands, north to the Ryukyu and Hawaiian islands, south to Lord Howe Island.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: East and South Africa, Madagascar and western Mascarenes east to Hawaiian Islands and Marquesas Islands, north to Taiwan, south to Western Australia, New Caledonia, Lord Howe Island, and Tonga.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13; Dorsal soft rays (total): 8 - 10; Analspines: 3; Analsoft rays: 5 - 6
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 140 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

14.0 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Inhabits areas of rich coral growth from near shore to the outer reef slope at depth of 49 m. Cryptic. Venomous spines.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Interorbital area and snout scaled; small spines at midline between tympanic spines frequently present; interorbital spines present; extra spines usually present on upper rear margin of eye after supraocular spine; dorsal spine, usually non longer than orbit diameter; body often covered with small skin flaps (Ref. 10482). Distinguished from other species of Scorpaenodes by having suborbital ridge with more than 5 spinous points, usually with 10 or more in adults (Ref. 10482).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 3 - 49 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 128 specimens in 1 taxon.
Water temperature and chemistry ranges based on 82 samples.

Environmental ranges
  Depth range (m): 0.5 - 37
  Temperature range (°C): 22.368 - 29.336
  Nitrate (umol/L): 0.043 - 2.714
  Salinity (PPS): 32.279 - 36.148
  Oxygen (ml/l): 4.446 - 5.032
  Phosphate (umol/l): 0.085 - 0.507
  Silicate (umol/l): 0.910 - 4.892

Graphical representation

Depth range (m): 0.5 - 37

Temperature range (°C): 22.368 - 29.336

Nitrate (umol/L): 0.043 - 2.714

Salinity (PPS): 32.279 - 36.148

Oxygen (ml/l): 4.446 - 5.032

Phosphate (umol/l): 0.085 - 0.507

Silicate (umol/l): 0.910 - 4.892
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 3 - 49m.
From 3 to 49 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found inshore (Ref. 75154). Conceal themselves in the interstices of corals, lying in wait for small prey to venture close enough to be captured (Ref. 275).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Scorpaenodes parvipinnis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTCTATCTAGTATTCGGTGCCTGAGCCGGAATAGTAGGCACAGCCCTAAGTCTGCTTATCCGGGCAGAACTAAGCCAACCCGGCGCTCTCCTTGGAGATGACCAAATTTATAATGTCATCGTTACAGCACATGCCTTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGGTTTGGAAACTGACTCATCCCACTAATGATTGGAGCCCCCGATATAGCATTTCCTCGCATGAATAACATGAGCTTCTGACTTCTTCCACCCTCTTTTCTCCTACTCCTGGCTTCTTCGGGGGTTGAGGCTGGCGCTGGAACGGGCTGAACAGTCTACCCGCCCTTGGCCGGTAACTTAGCCCACGCCGGTGCATCCGTCGACCTTACAATCTTTTCCCTGCACTTAGCAGGGATTTCATCAATCCTCGGTGCAATTAATTTTATCACCACAATCATTAATATAAAACCACCAGCAATTTCCCAATACCAGACTCCTTTATTTGTTTGGGCTGTGTTAATTACTGCCGTTCTTCTCCTCCTATCACTTCCAGTCCTTGCTGCAGGCATTACAATGCTCCTCACAGACCGGAACCTTAACACCACTTTTTTCGACCCCGCAGGCGGGGGGGACCCAATCCTTTACCAACACCT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Scorpaenodes parvipinnis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!