Overview

Comprehensive Description

Biology

Occurs from the surf line to close offshore (Ref. 5578). Feeds mainly on crustaceans (including lobsters), also squid (Ref. 244). Viviparous (Ref. 50449). Caught by rock and surf anglers (Ref. 5578).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species has an extremely restricted range in the Western Indian Ocean, off the east coast of South Africa (north¬eastern part of the Eastern Cape to northern KwaZulu-Natal). The Flapnose Houndshark is found close inshore at the surfline and in the intertidal (Compagno in prep. b).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Indian Ocean: Natal and northeastern Cape in South Africa.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Indian Ocean.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 890 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

89.0 cm TL (male/unsexed; (Ref. 244)); 102 cm TL (female)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

A blunt-nosed houndshark with large, fused nasal flaps, and small, blunt, pebble-like teeth; 2nd dorsal fin as large as 1st (Ref. 5578). Grey above, cream below; newborn with white rear edges on dorsal, anal and caudal fins (Ref. 5578).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This is a little-known and uncommon inshore demersal shark with an extremely restricted range. Less than 30 specimens recorded, including unpublished material. A live-bearing species (with presence or absence of placenta uncertain) with litter size of 2?4 (usually two or three) young and a gestation period of 9?10 months. It is unknown whether there is a year break in the reproductive cycle, but the low litter size suggests a year-long cycle and a yearly fecundity of similar numbers, 2?4 young per year (this needs further investigation). The species feeds predominantly on crustaceans, also squid (Compagno in prep. b).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 15 - 15
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Feeds on squids and crustaceans (Ref. 244, 5578).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Viviparous, placental (Ref. 50449). With 2 to 4 young in a litter (Ref. 244, 5578). Size at birth about 34 cm (Ref. 244). Gestation period is 9 to 10 months (Ref. 244). Distinct pairing with embrace (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Scylliogaleus quecketti

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTTTACTTGATTTTTGGTGCATGAGCAGGCATAGTTGGGACAGCCCTAAGCCTTCTAATTCGAGCCGAACTGGGACAGCCAGGATCGCTTTTAGGTGATGATCAGATTTACAATGTGATCGTAACCGCCCATGCTTTTGTAATAATCTTCTTTATGGTTATACCAATCATGATTGGTGGCTTTGGGAATTGACTGGTCCCATTAATAATTGGTGCACCAGATATAGCTTTTCCACGAATAAATAACATAAGCTTCTGACTCCTTCCCCCATCATTTCTTCTCCTTCTCGCCTCTGCAGGAGTAGAAGCTGGAGCGGGTACCGGTTGAACAGTTTACCCACCACTAGCAAGCAATTTAGCCCATGCTGGACCATCTGTTGATTTAGCCATCTTCTCCCTTCACTTAGCCGGTATTTCATCAATCTTAGCCTCAATTAACTTTATTACAACCATCATTAACATAAAACCACCAGCTATTTCCCAATACCAAACACCGTTATTTGTTTGATCCATTCTTGTAACCACTATTCTTCTTCTCCTCTCCCTTCCAGTTCTTGCAGCAGGAATTACAATATTACTCACAGACCGTAACCTTAACACTACATTCTTTGACCCTGCAGGCGGAGGAGACCCTATCCTTTACCAACATTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Scylliogaleus quecketti

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
B1ab(iii); C2a(ii)

Version
3.1

Year Assessed
2005

Assessor/s
Compagno, L.J.V.

Reviewer/s
Musick, J.A. & Fowler, S.L. (Shark Red List Authority)

Contributor/s

Justification
This assessment is based on the information published in the 2005 shark status survey (Fowler et al. 2005).

The Flapnose Houndshark (Scylliogaleus quecketti) is an uncommon species, the flapnose houndshark is of low fecundity and has a very restricted distribution in inshore waters of the western Indian Ocean (South Africa: KwaZulu-Natal and Eastern Cape) which are subjected to heavy fishing pressure and potential habitat degradation.

History
  • 2000
    Vulnerable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The Flapnose Houndshark occurs in inshore waters that are subjected to heavy commercial and sports hook-and-line fisheries. Small numbers have been taken in directed inshore fisheries for small sharks and the species has been sporadically utilised for its flesh recently in southern KwaZulu-Natal. No fisheries statistics are available on catches. It may also be a possible bycatch of inshore fisheries, but details are lacking. The species is caught by sports surf anglers and possibly recreational boat anglers. Increased fishing pressure in its limited environment suggests that the population may be vulnerable and could decline. Loss of habitat as a result of development and pollution along the coast of KwaZulu-Natal (where there is extensive coastal development) and the Eastern Cape during the last few decades may also be a threat.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Vulnerable (VU) (B1ab(iii); C2a(ii))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: subsistence fisheries; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Flapnose houndshark

The flapnose houndshark, Scylliogaleus quecketti, is a houndshark of the family Triakidae, and the only member of the genus Scylliogaleus. It is found in the waters off subtropical South Africa, in the western Indian Ocean between latitudes 27° S and 33° S.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!