Overview

Comprehensive Description

Biology

Benthic on sand (Ref. 58302).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Northwest Pacific: Midway Islands and Emperor Seamount. Eastern Central Pacific: Hawaii.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: North Carolina (U. S. A.) and Gulf of Mexico south to northern South America; Central Pacific: Hawaiian Ridge, Hawaiian Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 30 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

3.0 cm SL (male/unsexed; (Ref. 11412))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Chascanopsetta prorigera
Catalog Number: USNM 51605
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Year Collected: 1902
Locality: N.E. + N. Coast of Maui Island, Puniawa Point, Maui, Hawaii, United States, Hawaiian Islands, Pacific
Depth (m): 326 to 369
Vessel: Albatross
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

bathydemersal; marine; depth range 267 - 400 m (Ref. 11412)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 6 specimens in 1 taxon.
Water temperature and chemistry ranges based on 6 samples.

Environmental ranges
  Depth range (m): 267 - 576
  Temperature range (°C): 7.192 - 14.431
  Nitrate (umol/L): 8.216 - 30.828
  Salinity (PPS): 34.122 - 35.431
  Oxygen (ml/l): 2.767 - 4.919
  Phosphate (umol/l): 0.722 - 2.051
  Silicate (umol/l): 7.938 - 24.116

Graphical representation

Depth range (m): 267 - 576

Temperature range (°C): 7.192 - 14.431

Nitrate (umol/L): 8.216 - 30.828

Salinity (PPS): 34.122 - 35.431

Oxygen (ml/l): 2.767 - 4.919

Phosphate (umol/l): 0.722 - 2.051

Silicate (umol/l): 7.938 - 24.116
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 267 - 400m.
From 267 to 400 meters.

Habitat: bathydemersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chascanopsetta prorigera

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CTTTATCTTGAATTTGGTGCCTGGGCTGCGATAGTAGGGACGGCAGTAAGTCTCCTTAATCGAGCAGAGCTTAATCAACCGGGGGCACTCCTCGGAGAC---GACCAGATTTACAACGTCATCGTCACGGCCCATGCCTTCGTAATAATCTTCTTTATAGTAATACCTATCATGATCGGGGGGTTCGGGAACTGACTAGTACCCCTCATGATCGGGGCACCAGACATGGCGTTCCCGCGTATGAATAACATGAGCTTCTGGCTACTCCCCCCATCATTCCTCCTGCTCCTCTGCTCTTCAGGCGTAGAGGCCGGCGCTGGGACCGGATGAACGGTGTATCCCCCTCTTGCAGGGAACCTTGCCCATGCCGGTGCATCTGTTGACTTAACTATTTTTTCACTCCACCTCGCTGGTGTGTCTTCAATTTTAGGTGCTATTAACTTTATCACAACTATTGTTAACATGAAACCAGCACCCATAACGATGTACCAACTACCATTGTTTGTATGGGCAGTGCTGATTACAGCCGTTCTTCTGCTTCTTTCTCTCCCCGTCCTAGCCGCGGGGATCACGATGCTTCTCACCGACCGTAACCTAAATACCGCATTCTTTGACCCGGCCGGCGGGGGGGACCCAATCCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Chascanopsetta prorigera

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!