Overview

Comprehensive Description

Biology

Found in lakes, rivers and streams between 0 and 600 m elevation. The young feed on terrestrial and aquatic insects, leaves, fruits and seeds but become mainly herbivorous when adult. Eggs are deposited in nests located in sand bottoms of streams.
  • Lima, F.C.T. 2003 Characidae - Bryconinae (Characins, tetras). p. 174-181. In R.E. Reis, S.O. Kullander and C.J. Ferraris, Jr. (eds.) Checklist of the Freshwater Fishes of South and Central America. Porto Alegre: EDIPUCRS, Brasil. (Ref. 38504)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Central America: Atlantic slope from Grijalva River, Mexico to eastern Panama; in the Pacific slope, only in Choluteca River basin of Honduras.
  • Lima, F.C.T. 2003 Characidae - Bryconinae (Characins, tetras). p. 174-181. In R.E. Reis, S.O. Kullander and C.J. Ferraris, Jr. (eds.) Checklist of the Freshwater Fishes of South and Central America. Porto Alegre: EDIPUCRS, Brasil. (Ref. 38504)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Atlantic slope from Mexico to eastern Panama; Pacific slope in Choluteca River basin of Honduras: Belize, Costa Rica, Guatemala, Honduras, Mexico, Nicaragua and Panama.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 580 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

59.0 cm TL (male/unsexed; (Ref. 40637)); max. published weight: 4,320 g (Ref. 40637)
  • IGFA 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA. (Ref. 40637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

benthopelagic; freshwater; depth range 0 - 600 m
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 600m.
Recorded at 600 meters.

Habitat: pelagic. Found in lakes, rivers and streams. Water temperature: 21-34°C. The young feed on terrestial and aquatic insects, leaves, fruits and seeds but become mainly herbivorous when adult. Eggs are deposited in nests located in sand bottoms of streams.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found in lakes, rivers and streams. Water temperature: 21-34°C. The young feed on terrestrial and aquatic insects, leaves, fruits and seeds but become mainly herbivorous when adult.
  • Bussing, W.A. 1987 Peces de las aguas continentales de Costa Rica. Editorial de la Universidad de Costa Rica ciudad Universitaria Rodrigo Facio. San Jose. (Ref. 6858)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Brycon guatemalensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACCTGGTATTCGGTGCCTGAGCCGGAATAGTTGGCACGGCCCTCAGCCTTCTAATTCGAGCAGAGCTTAGCCAACCCGGGTCCTTACTAGGCGATGATCAAATTTACAATGTCATTGTTACCGCACACGCGTTTGTAATAATCTTCTTTATAGTCATGCCAGTAATGATTGGCGGCTTCGGAAATTGACTGGTGCCCCTAATGATTGGTGCCCCAGATATAGCCTTTCCACGAATAAATAATATAAGTTTTTGGCTTCTACCCCCATCTTTCCTCCTCCTCTTAGCCTCCTCGGGTGTTGAAGCTGGAGCAGGGACCGGTTGGACTGTTTACCCGCCTCTTGCAGGAAACTTAGCTCACGCAGGGGCCTCCGTAGATTTAACTATTTTCTCCCTGCATCTCGCCGGAGTTTCTTCGATTCTCGGGGCAATCAACTTTATTACAACAATCATTAACATGAAACCCCCAGCCATCTCTCAGTATCAAACGCCCCTATTCGTCTGAGCCGTGCTGGTCACAGCCGTTCTTTTACTTCTCTCTCTGCCAGTCCTAGCAGCTGGAATCACCATGCTTTTGACAGACCGAAATCTCAACACCACCTTCTTTGACCCTGCGGGAGGGGGAGATCCAATTCTTTATCAACATCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Brycon guatemalensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

gamefish: yes
  • Crawford, R. 1993 World record game fishes 1993. The International Game Fish Association, Pompano Beach, Florida. (Ref. 6323)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!