Overview

Comprehensive Description

Biology

Found in lakes, rivers and streams between 0 and 600 m elevation. The young feed on terrestrial and aquatic insects, leaves, fruits and seeds but become mainly herbivorous when adult. Eggs are deposited in nests located in sand bottoms of streams.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Central America: Atlantic slope from Grijalva River, Mexico to eastern Panama; in the Pacific slope, only in Choluteca River basin of Honduras.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Atlantic slope from Mexico to eastern Panama; Pacific slope in Choluteca River basin of Honduras: Belize, Costa Rica, Guatemala, Honduras, Mexico, Nicaragua and Panama.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 580 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

59.0 cm TL (male/unsexed; (Ref. 40637)); max. published weight: 4,320 g (Ref. 40637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

benthopelagic; freshwater; depth range 0 - 600 m
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 600m.
Recorded at 600 meters.

Habitat: pelagic. Found in lakes, rivers and streams. Water temperature: 21-34°C. The young feed on terrestial and aquatic insects, leaves, fruits and seeds but become mainly herbivorous when adult. Eggs are deposited in nests located in sand bottoms of streams.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Found in lakes, rivers and streams. Water temperature: 21-34°C. The young feed on terrestrial and aquatic insects, leaves, fruits and seeds but become mainly herbivorous when adult.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Brycon guatemalensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACCTGGTATTCGGTGCCTGAGCCGGAATAGTTGGCACGGCCCTCAGCCTTCTAATTCGAGCAGAGCTTAGCCAACCCGGGTCCTTACTAGGCGATGATCAAATTTACAATGTCATTGTTACCGCACACGCGTTTGTAATAATCTTCTTTATAGTCATGCCAGTAATGATTGGCGGCTTCGGAAATTGACTGGTGCCCCTAATGATTGGTGCCCCAGATATAGCCTTTCCACGAATAAATAATATAAGTTTTTGGCTTCTACCCCCATCTTTCCTCCTCCTCTTAGCCTCCTCGGGTGTTGAAGCTGGAGCAGGGACCGGTTGGACTGTTTACCCGCCTCTTGCAGGAAACTTAGCTCACGCAGGGGCCTCCGTAGATTTAACTATTTTCTCCCTGCATCTCGCCGGAGTTTCTTCGATTCTCGGGGCAATCAACTTTATTACAACAATCATTAACATGAAACCCCCAGCCATCTCTCAGTATCAAACGCCCCTATTCGTCTGAGCCGTGCTGGTCACAGCCGTTCTTTTACTTCTCTCTCTGCCAGTCCTAGCAGCTGGAATCACCATGCTTTTGACAGACCGAAATCTCAACACCACCTTCTTTGACCCTGCGGGAGGGGGAGATCCAATTCTTTATCAACATCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Brycon guatemalensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!