Overview

Distribution

Range Description

The species occurs throughout Mexico, Mesoamerica and into Colombia, and four states in the United States of America. In Belize it has been recorded from Cayo.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The species prefers clean streams and flowing ditches, usually wooded but sometimes in the open. Also found in garden ponds in Texas.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Libellula croceipennis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTATTACCTCCATCATTTACACTTTTATTAGCAAGAAGAATAGTTGAAAGAGGGGCAGGAACTGGATGAACCGTTTATCCCCCTCTTGCAGGAGCAATTGCTCATGCAGGAGCATCTGTAGATCTAACAATCTTTTCTTTACATTTAGCAGGTGTATCATCTATTCTTGGAGCAATTAATTTTATTACAACAGTAATTAATATAAAGTCACCCGGAATAAAAATAGATCAAATACCCCTATTTGTATGAGCAGTAGTAATTACTGCAGTATTACTACTTTTATCTTTACCTGTATTAGCAGGTGCTATTACTATACTATTAACTGACCGAAATATTAATACCTCATTTTTTGACCCCGCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTTTGATTTTTTGGCCTACCAGAAGTTTATATTTTAATCCTACCAGGATTTGGTATAATTTCACATATTATTGCTCAAGAAAGAGGAAAAAAGGAAACATTTGGAGTACTAGGAATAATCTATGCCATAGTAGCAATTGGAATTCTTGGTTTCGTTGTATGAGCACATCACATATTTACTGTAGGTATAGATGTTGATACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Libellula croceipennis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Paulson, D. R.

Reviewer/s
Clausnitzer, V. & Kalkman, V. (Odonata Red List Authority)

Contributor/s

Justification
L. croceipennis is reasonably widespread and common throughout its range, present in protected areas and with no indication of any population decline.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
L. croceipennis is locally common in many populations.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are no threats presently affecting this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species is present in some protected areas (national parks, national wildlife refuges, state parks) in the United States. Occurrence south of the United States border have not been documented. It does not appear to require further conservation measures at present.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Neon Skimmer

The Neon Skimmer (Libellula croceipennis) is a dragonfly of the skimmer family. It can be found near ponds, lakes and slow moving streams in the southwest United States, Central America, and northern South America.[2]

References

  1. ^ "Libellula croceipennis". Integrated Taxonomic Information System. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=101909.
  2. ^ Abbott, John C. (2005). Dragonflies and Damselflies of Texas and the South-Central United States. Princeton University Press. pp. 269–270. ISBN 0-691-11364-5.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!