Overview

Comprehensive Description

Biology

Freshwater. Generally associated with warmwater habitats and tolerant of variation in terms of discharge, water temperature, and substrate. Mainly inhabits warmwater, isolated segments of moderate-sized to large streams with summer flows 0.03-31 m3/s, summer water temperatures 14-25.6 ?C (Ref.89241). Adults inhabit clean, clear gravel riffles and runs of small rivers. Ammocoetes occur in quiet water over sand, silt and debris (Ref.1998). Metamorphosis occurs in late August to September, in Michigan and extends to early October in Québec (Ref. 89241). Non-parasitic, the adults and possibly the larger ammocoetes in the resting stage do not feed (Ref. 1998). Adults live less than 6 months. In Michigan, the spawning period is from 13 May to 6 July, at water temperatures between 12.8-23.3 ?C, with peak spawning activity in late May to mid-June. In Québec, spawning occurs in May, at water temperatures between 12.8-17.2 °C, peaking at temperatures between 13.3-15.6 °C. Nests are usually in the open and are poorly defined, but have also been found downstream of large stones 18-36 cm in diameter, or on a patch of gravel downstream of a submerged log. The nests are found in streams having 3.5-8 m width, 10-61 cm depth, and 0.1-0.6 m3/s flow. Up to 13 spawning lampreys have been found in a nest. There are reported occurrences in Michigan of communal spawning of Northern Brook Lamprey with Silver Lamprey (Pine River), and of Northern Brook Lamprey with Sea Lamprey (Devils River). Fecundity, 1,200 eggs/female. During spawning, adults preyed upon by Ambloplites rupestris. In the Laurentian Great Lakes Basin, it has been negatively affected by control measures directed towards Petromyzon marinus, except for the chemosterilization of males, which affects only the latter species. Vladykov (1949) reported that in the province of Québec, Canada, fishermen use ammocoetes as bait for sportfishes (Ref. 89241).
  • Robins, C.R., R.M. Bailey, C.E. Bond, J.R. Brooker, E.A. Lachner, R.N. Lea and W.B. Scott 1991 Common and scientific names of fishes from the United States and Canada. Am. Fish. Soc. Spec. Pub. (20):183 p. (Ref. 3814)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Range extends from the St. Lawrence River, Quebec, west through Great Lakes and northern Mississippi River basins to Red River (Hudson Bay basin), southern Manitoba; localized in Ohio River basin from northwestern Pennsylvania to eastern Kentucky; Missouri River basin, Ozark Uplands, Missouri (Pflieger 1997, Page and Burr 2011)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Range extends from the St. Lawrence River, Quebec, west through Great Lakes and northern Mississippi River basins to Red River (Hudson Bay basin), southern Manitoba; localized in Ohio River basin from northwestern Pennsylvania to eastern Kentucky; Missouri River basin, Ozark Uplands, Missouri (Pflieger 1997, Page and Burr 2011)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America: St. Lawrence River, Quebec, west through Great Lakes and northern Mississippi River basin to Red River (Hudson Bay basin), south Manitoba; localized in Ohio River basin of northwest Pennsylvania, west Virginia, east Kentucky, north and south central Ohio and north Indiana; Missouri River basin.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 16 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 170 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

17.0 cm TL (male/unsexed; (Ref. 5723)); max. reported age: 6 years (Ref. 72462)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Adults: 8.6-16.6 cm TL. Body proportions, as percentage of TL (based on 59 specimens measuring 9.8-15.8 cm TL): prebranchial length, 7.4-9.9; branchial length, 8.7-11.9; trunk length, 46.7-54.6; tail length, 27.7-33.7; eye length, 1.0-2.0; disc length, 3.6-6.4. The urogenital papilla length, as a percentage of branchial length, in 25 spawning males measuring 9.9-14.95 cm TL, 6.7-21.7. Trunk myomeres, 47-58. Dentition: supraoral lamina, 1-4 unicuspid teeth, usually 2; infraoral lamina, 6-11 teeth, usually unicuspid but one may be bicuspid; 4 endolateral teeth on each side; 0-1, strong mode of 0, bicuspid endolaterals in total, the other endolaterals unicuspid; 1-3 rows of anterials; first row of anterials, 3 unicuspid teeth; 1-5 rows of exolaterals on each side, usually 3-4; 2-3 rows of posterials; first row of posterials, 10-11 unicuspid teeth; crest of transverse lingual lamina strongly w-shaped and with either indistinct or about 20 small cusps, the median one not enlarged; longitudinal lingual laminae with 17 cusps each. Marginal membrane vestigial. A small gular pouch is present in both males and females. Velar tentacles, 1-2, smooth. Body coloration (preserved) in adults darker (grayish brown) on the dorsal and upper lateral aspects and lighter (pale gray or silvery white) on the lower lateral and ventral aspects, giving a distinctly bicolored appearance. Lateral line neuromasts unpigmented. Extent of caudal fin pigmentation, 25% to more than 75%. Caudal fin shape, rounded.
  • Renaud, C.B. 2011 Lampreys of the world. An annotated and illustrated catalogue of lamprey species known to date. FAO Species Catalogue for Fishery Purposes. No. 5. Rome, FAO. 109 pp. (Ref. 89241)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: Habitat includes clean, clear gravel riffles and runs of small rivers (Page and Burr 2011); this species usually does not occur in large rivers or small brooks. Usually it occurs over gravel or sand-silt bottoms in moderately warm water, generally unsuitable for brook trout (Becker 1983). Larvae burrow into sand-silt bottoms in eddies. Spawning occurs in coarse gravelly or stony bottoms of creeks or small rivers in areas of strong current.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Habitat includes clean, clear gravel riffles and runs of small rivers (Page and Burr 2011); this species usually does not occur in large rivers or small brooks. Usually it occurs over gravel or sand-silt bottoms in moderately warm water, generally unsuitable for brook trout (Becker 1983). Larvae burrow into sand-silt bottoms in eddies. Spawning occurs in coarse gravelly or stony bottoms of creeks or small rivers in areas of strong current.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 3 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0.2 - 1

Graphical representation

Depth range (m): 0.2 - 1
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Adults inhabit clean, clear gravel riffles and runs of small rivers. Ammocoetes occur in quiet water over sand, silt and debris. Non-parasitic, the adults and possibly the larger ammocoetes in the resting stage do not feed (Ref. 1998). Ammocoetes feed on diatoms, protozoans, green algae, detritus, and pollen. The intestine is nonfunctional (Ref. 1998).
  • Scott, W.B. and E.J. Crossman 1973 Freshwater fishes of Canada. Bull. Fish. Res. Board Can. 184:1-966. (Ref. 1998)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Adults and possibly the larger larvae do not feed. Larvae filter feed on microscopic organisms (diatoms, algae, etc.).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 21 - 300

Comments: This species is represented by a large number of occurrences (subpopulations). Becker (1983) mapped several dozen collection sites in Wisconsin, representing probably a few dozen distinct occurrences; he stated that the species is probably more widely distributed than present records indicate. Pflieger (1997) mapped 18 collection sites (1945-1995) in three well-isolated river systems in Missouri; he stated that due to identification problems with larvae, the species may be more widely distributed that available records suggest. Burr and Warren (1986) mapped 18 collection sites in several drainages Kentucky; these represent probably about a dozen distinct occurrences, but the species was rated as threatened there. Smith (1979) mapped three collection sites in Illinois all in one river.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 - 1,000,000 individuals

Comments: Total adult population size is unknown but presumably exceeds 10,000. Rage-wide, this species is locally common (Page and Burr 2011); occasional and uncommon in Kentucky (Burr and Warren 1986); common in at least two river systems in Wisconsin (Becker 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Spawns in late spring. Eggs hatch in about 12 days. Larval stage lasts about 3-6 years. Metamorphosis occurs in late summer. Adults overwinter, spawn the following spring, die after undetermined time thereafter (Becker 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ichthyomyzon fossor

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 16 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATATTTAATTTTTGGGGCCTGAGCAGGAATAGTAGGAACCGCTTTAAGCATCCTAATTCGAGCAGAACTAAGTCAACCAGGCACTTTACTAGGAGACGACCAAATTTTTAATGTTATCGTAACCGCCCATGCTTTCGTCATAATCTTTTTCATAGTTATACCAATCATAATTGGAGGCTTTGGTAACTGACTTGTGCCACTAATACTAAGCGCCCCAGATATGGCCTTCCCACGTATAAACAACATAAGCTTTTGATTACTTCCACCATCATTACTTCTACTTTTAGCCTCCGCAGGAGTTGAAGCTGGGGCAGGAACAGGATGAACTGTATATCCCCCATTAGCCGGAAATTTAGCTCATACAGGAGCATCTATTGACTTAACAATCTTCTCCCTTCACCTCGCTGGAATTTCATCAATTTTAGGAGCAATTAATTTTATCACAACTATTTTTAATATAAAACCCCCAACTATAACTCAATATCAAACTCCTTTATTTGTTTGATCCGTCCTAATTACTGCAGTCCTTCTCCTATTATCTCTACCAGTACTGGCAGCCGCTATCACAATACTCCTTACAGATCGTAACTTAAATACATCCTTCTTTGACCCTGCGGGGGGAGGAGACCCCATTCTATACCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ichthyomyzon fossor

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 16
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N3 - Vulnerable

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Environmental Specificity: Narrow. Specialist or community with key requirements common.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
Listed as Least Concern in view of the large extent of occurrence, large number of subpopulations and locations, and probable large population size, and because the species probably is not declining fast enough to qualify for any of the threatened categories.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable to decline of 30%

Comments: Trend over the past 10 years or three generations is uncertain but probably relatively stable or slowly declining.

Global Long Term Trend: Decline of 50-70%

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is represented by a large number of occurrences (subpopulations). Becker (1983) mapped several dozen collection sites in Wisconsin, representing probably a few dozen distinct occurrences; he stated that the species is probably more widely distributed than present records indicate. Pflieger (1997) mapped 18 collection sites (1945-1995) in three well-isolated river systems in Missouri; he stated that due to identification problems with larvae, the species may be more widely distributed that available records suggest. Burr and Warren (1986) mapped 18 collection sites in several drainages Kentucky; these represent probably about a dozen distinct occurrences, but the species was rated as threatened there. Smith (1979) mapped three collection sites in Illinois all in one river.

Total adult population size is unknown but presumably exceeds 10,000. Rage-wide, this species is locally common (Page and Burr 2011); occasional and uncommon in Kentucky (Burr and Warren 1986); common in at least two river systems in Wisconsin (Becker 1983).

Trend over the past 10 years or three generations is uncertain but probably relatively stable or slowly declining.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Degree of Threat: Medium

Comments: No major threats are known, but the species is vulnerable to local extirpation through indiscriminant use of fish toxicants (Becker 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
No major threats are known, but the species is vulnerable to local extirpation through indiscriminant use of fish toxicants (Becker 1983).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Global Protection: Unknown whether any occurrences are appropriately protected and managed

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Actions

Conservation Actions
Currently, this species is of relatively low conservation concern and does not require significant additional protection or major management, monitoring, or research action.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

bait: occasionally
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Northern Brook Lamprey

The northern brook lamprey (Ichthyomyzon fossor) is a lamprey found in North America throughout the Great Lakes Watershed. There are limited populations within the Mississippi watershed.

Life cycle[edit]

Adults spawn in the spring in the headwaters of streams. The males (aided by females) construct small nests by picking up pebbles with their mouths and moving them to form the rims of shallow depressions. The sticky eggs are deposited in the nest and adhere to the sand and gravel. Multiple adults may spawn in the same nest, and multiple males may spawn with the same female. As with all lamprey adults die after spawning.

When they first hatch embryos remain in the nest for up to one month before they mature into ammocoetes. Ammocoetes leave the nest and seek out slow flowing sandy areas, where they burrow and begin feeding. Ammocoetes live burrowed for 3-7 years, feeding on microscopic plant and animal life and detritus (decaying matter). Mature ammocoetes will begin to metamorphosis in the late summer through the fall.

References[edit]

  • Reighard and Cummins, Description of a new species of lamprey of the genus Ichthyomyzon, 1916
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Ichthyomyzon fossor and I. unicuspis may "represent ecotypes of a single species since, where they are sympatric, they appear to be experiencing ongoing gene flow" (Docker et al. 2012; see also Docker 2009).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!