Overview

Comprehensive Description

Biology

Freshwater. Generally associated with warmwater habitats and tolerant of variation in terms of discharge, water temperature, and substrate. Mainly inhabits warmwater, isolated segments of moderate-sized to large streams with summer flows 0.03-31 m3/s, summer water temperatures 14-25.6 ?C (Ref.89241). Adults inhabit clean, clear gravel riffles and runs of small rivers. Ammocoetes occur in quiet water over sand, silt and debris (Ref.1998). Metamorphosis occurs in late August to September, in Michigan and extends to early October in Québec (Ref. 89241). Non-parasitic, the adults and possibly the larger ammocoetes in the resting stage do not feed (Ref. 1998). Adults live less than 6 months. In Michigan, the spawning period is from 13 May to 6 July, at water temperatures between 12.8-23.3 ?C, with peak spawning activity in late May to mid-June. In Québec, spawning occurs in May, at water temperatures between 12.8-17.2 °C, peaking at temperatures between 13.3-15.6 °C. Nests are usually in the open and are poorly defined, but have also been found downstream of large stones 18-36 cm in diameter, or on a patch of gravel downstream of a submerged log. The nests are found in streams having 3.5-8 m width, 10-61 cm depth, and 0.1-0.6 m3/s flow. Up to 13 spawning lampreys have been found in a nest. There are reported occurrences in Michigan of communal spawning of Northern Brook Lamprey with Silver Lamprey (Pine River), and of Northern Brook Lamprey with Sea Lamprey (Devils River). Fecundity, 1,200 eggs/female. During spawning, adults preyed upon by Ambloplites rupestris. In the Laurentian Great Lakes Basin, it has been negatively affected by control measures directed towards Petromyzon marinus, except for the chemosterilization of males, which affects only the latter species. Vladykov (1949) reported that in the province of Québec, Canada, fishermen use ammocoetes as bait for sportfishes (Ref. 89241).
  • Robins, C.R., R.M. Bailey, C.E. Bond, J.R. Brooker, E.A. Lachner, R.N. Lea and W.B. Scott 1991 Common and scientific names of fishes from the United States and Canada. Am. Fish. Soc. Spec. Pub. (20):183 p. (Ref. 3814)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Northern brook lamprey are found in many areas of the midwestern and northeastern United States, including the Mississippi River drainage in Wisconsin, northeastern Illinois, and northern Indiana, and in parts of Canada. They are also found in a Lake Erie tributary in New York and certain tributaries of the St. Lawrence River in Quebec, Canada.

Biogeographic Regions: nearctic (Native )

  • Hubbs, C., K. Lagler. 1958. Fishes of the Great Lakes Region. Bloomfield Hills, Michigan: Cranbrook Institute of Science.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Range extends from the St. Lawrence River, Quebec, west through Great Lakes and northern Mississippi River basins to Red River (Hudson Bay basin), southern Manitoba; localized in Ohio River basin from northwestern Pennsylvania to eastern Kentucky; Missouri River basin, Ozark Uplands, Missouri (Pflieger 1997, Page and Burr 2011)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Range extends from the St. Lawrence River, Quebec, west through Great Lakes and northern Mississippi River basins to Red River (Hudson Bay basin), southern Manitoba; localized in Ohio River basin from northwestern Pennsylvania to eastern Kentucky; Missouri River basin, Ozark Uplands, Missouri (Pflieger 1997, Page and Burr 2011)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America: St. Lawrence River, Quebec, west through Great Lakes and northern Mississippi River basin to Red River (Hudson Bay basin), south Manitoba; localized in Ohio River basin of northwest Pennsylvania, west Virginia, east Kentucky, north and south central Ohio and north Indiana; Missouri River basin.
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Northern brook lamprey appear very similar throughout their life cycle. This species has a continuous dorsal fin that may or may not be divided by a small notch and is connected to a round, short caudal fin. Individuals are grayish brown dorsally with a pale median line down the back and a lighter ventral side, with the posterior end darker in color (almost black). There are a few differences between ammocoetes and adults: ammocoetes have neither eyes nor a sucking disk mouth (they have a hooded mouth instead). Adults have eyes and disk-shaped mouths with small, poorly developed teeth. Once adults are of breeding age it is possible to differentiate between the sexes (males have a urogenital papilla and females have an enlarged post-anal fold).

Average mass: 2.2 g.

Average length: 16 cm.

Other Physical Features: ectothermic ; bilateral symmetry

Sexual Dimorphism: female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 16 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 170 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

17.0 cm TL (male/unsexed; (Ref. 5723)); max. reported age: 6 years (Ref. 72462)
  • Altman, P.L. and D.S. Dittmer 1962 Growth, including reproduction and morphological development. Federation of American Societies for Experimental Biology. (Ref. 72462)
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Adults: 8.6-16.6 cm TL. Body proportions, as percentage of TL (based on 59 specimens measuring 9.8-15.8 cm TL): prebranchial length, 7.4-9.9; branchial length, 8.7-11.9; trunk length, 46.7-54.6; tail length, 27.7-33.7; eye length, 1.0-2.0; disc length, 3.6-6.4. The urogenital papilla length, as a percentage of branchial length, in 25 spawning males measuring 9.9-14.95 cm TL, 6.7-21.7. Trunk myomeres, 47-58. Dentition: supraoral lamina, 1-4 unicuspid teeth, usually 2; infraoral lamina, 6-11 teeth, usually unicuspid but one may be bicuspid; 4 endolateral teeth on each side; 0-1, strong mode of 0, bicuspid endolaterals in total, the other endolaterals unicuspid; 1-3 rows of anterials; first row of anterials, 3 unicuspid teeth; 1-5 rows of exolaterals on each side, usually 3-4; 2-3 rows of posterials; first row of posterials, 10-11 unicuspid teeth; crest of transverse lingual lamina strongly w-shaped and with either indistinct or about 20 small cusps, the median one not enlarged; longitudinal lingual laminae with 17 cusps each. Marginal membrane vestigial. A small gular pouch is present in both males and females. Velar tentacles, 1-2, smooth. Body coloration (preserved) in adults darker (grayish brown) on the dorsal and upper lateral aspects and lighter (pale gray or silvery white) on the lower lateral and ventral aspects, giving a distinctly bicolored appearance. Lateral line neuromasts unpigmented. Extent of caudal fin pigmentation, 25% to more than 75%. Caudal fin shape, rounded.
  • Renaud, C.B. 2011 Lampreys of the world. An annotated and illustrated catalogue of lamprey species known to date. FAO Species Catalogue for Fishery Purposes. No. 5. Rome, FAO. 109 pp. (Ref. 89241)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

The habitat of northern brook lamprey varies throughout the life cycle. Adults are generally found in areas of rapidly flowing water above a very coarse bed, spawning and then laying eggs in crevices beneath rocks and boulders. Ammocoetes (larvae) are generally found in the the calmer waters of brook, stream and river side channels where there is fine sediment or organic debris in which to burrow.

Range depth: 0.7 (low) m.

Habitat Regions: temperate ; freshwater

Aquatic Biomes: rivers and streams

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Habitat includes clean, clear gravel riffles and runs of small rivers (Page and Burr 2011); this species usually does not occur in large rivers or small brooks. Usually it occurs over gravel or sand-silt bottoms in moderately warm water, generally unsuitable for brook trout (Becker 1983). Larvae burrow into sand-silt bottoms in eddies. Spawning occurs in coarse gravelly or stony bottoms of creeks or small rivers in areas of strong current.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Habitat includes clean, clear gravel riffles and runs of small rivers (Page and Burr 2011); this species usually does not occur in large rivers or small brooks. Usually it occurs over gravel or sand-silt bottoms in moderately warm water, generally unsuitable for brook trout (Becker 1983). Larvae burrow into sand-silt bottoms in eddies. Spawning occurs in coarse gravelly or stony bottoms of creeks or small rivers in areas of strong current.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 3 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0.2 - 1

Graphical representation

Depth range (m): 0.2 - 1
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Northern brook lamprey only feed as ammocoetes. During this time, they feed mainly on organic detrius, diatoms, desmids, protozoans, algae and pollen.

Plant Foods: pollen; algae

Other Foods: detritus ; microbes

Foraging Behavior: filter-feeding

Primary Diet: herbivore (Algivore); detritivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Adults inhabit clean, clear gravel riffles and runs of small rivers. Ammocoetes occur in quiet water over sand, silt and debris. Non-parasitic, the adults and possibly the larger ammocoetes in the resting stage do not feed (Ref. 1998). Ammocoetes feed on diatoms, protozoans, green algae, detritus, and pollen. The intestine is nonfunctional (Ref. 1998).
  • Scott, W.B. and E.J. Crossman 1973 Freshwater fishes of Canada. Bull. Fish. Res. Board Can. 184:1-966. (Ref. 1998)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Adults and possibly the larger larvae do not feed. Larvae filter feed on microscopic organisms (diatoms, algae, etc.).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Although morthern brook lamprey often share habitat with mayfly nymphs and small mussels, there is little evidence that there is any competition amongst these species. Unlike many lamprey species, this species is non-parasitic. There is currently no research available regarding parasites of northern brook lamprey.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This species is prey for many larger fish throughout its life. While eggs and ammocoetes are particularly vulnerable, adults may be consumed as well. Known predators include rainbow trout, rock bass and brown trout.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 21 - 300

Comments: This species is represented by a large number of occurrences (subpopulations). Becker (1983) mapped several dozen collection sites in Wisconsin, representing probably a few dozen distinct occurrences; he stated that the species is probably more widely distributed than present records indicate. Pflieger (1997) mapped 18 collection sites (1945-1995) in three well-isolated river systems in Missouri; he stated that due to identification problems with larvae, the species may be more widely distributed that available records suggest. Burr and Warren (1986) mapped 18 collection sites in several drainages Kentucky; these represent probably about a dozen distinct occurrences, but the species was rated as threatened there. Smith (1979) mapped three collection sites in Illinois all in one river.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 - 1,000,000 individuals

Comments: Total adult population size is unknown but presumably exceeds 10,000. Rage-wide, this species is locally common (Page and Burr 2011); occasional and uncommon in Kentucky (Burr and Warren 1986); common in at least two river systems in Wisconsin (Becker 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Although ammocoetes are blind, adult Northern brook lamprey have small eyes. This species also has a lateral line through which the fish may sense vibrations.

Communication Channels: tactile ; chemical

Perception Channels: visual ; tactile ; vibrations ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Northern brook lamprey have two developmental stages: ammocoete (larval) and adult. Larvae hatch approximately 2 weeks after egg fertilization and drift downstream before burrowing into the substrate. Once settled in burrows, larvae feed on suspended algae, bacteria and other detrius for 5-6 years until they metamorphose into non-feeding juveniles, typically in the fall. The transformation process lasts for 2-3 months. Juveniles spend 4-6 months drifting until spring, when spawning occurs and they become sexually mature adults. Adults die shortly after spawning.

Development - Life Cycle: metamorphosis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Northern brook lamprey typically live for 5-8 years in the wild, dying within a few days of reaching sexual maturity and completing mating. There is no data available regarding captive lifespan.

Average lifespan

Status: wild:
7 years.

Typical lifespan

Status: wild:
5 to 8 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

During mating, 3-7 northern brook lamprey will build a nest together and spawn in groups of 10-30. Once eggs are fertilized and laid they are often covered with the substrate surrounding the nest.

Mating System: polygynandrous (promiscuous)

Northern brook lamprey spawn in the spring at approximately 6 years of age, just after reaching sexual maturity. Females lay thousands of eggs, possibly due to high mortality rates during the early stages of the species' life cycle. Eggs hatch 2-4 weeks after fertilization.

Spawning is initiated when water temperatures are between 13 and 20.5°C. Males begin nest building by moving stones and gravel to create a small dip in the substrate within shallow, pool-riffle, high-gradient stretches of streams.

During spawning, these lampreys coil together in groups of 3 to 7 individuals before going into the nest. Once in the nest a male attaches to, but does not wrap around, a female (as in some other lamprey species) to complete egg fertilization. Adults then leave the nest and die soon thereafter.

Breeding interval: Northern brook lamprey spawn once during their lifetimes.

Breeding season: Spring

Range number of offspring: 1,115 to 1,979.

Average number of offspring: 1,200.

Range age at sexual or reproductive maturity (female): 5 to 7 years.

Range age at sexual or reproductive maturity (male): 5 to 7 years.

Key Reproductive Features: semelparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

There is no parental investment by adults of this species as they die soon after egg fertilization.

Parental Investment: no parental involvement

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Spawns in late spring. Eggs hatch in about 12 days. Larval stage lasts about 3-6 years. Metamorphosis occurs in late summer. Adults overwinter, spawn the following spring, die after undetermined time thereafter (Becker 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ichthyomyzon fossor

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 16 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATATTTAATTTTTGGGGCCTGAGCAGGAATAGTAGGAACCGCTTTAAGCATCCTAATTCGAGCAGAACTAAGTCAACCAGGCACTTTACTAGGAGACGACCAAATTTTTAATGTTATCGTAACCGCCCATGCTTTCGTCATAATCTTTTTCATAGTTATACCAATCATAATTGGAGGCTTTGGTAACTGACTTGTGCCACTAATACTAAGCGCCCCAGATATGGCCTTCCCACGTATAAACAACATAAGCTTTTGATTACTTCCACCATCATTACTTCTACTTTTAGCCTCCGCAGGAGTTGAAGCTGGGGCAGGAACAGGATGAACTGTATATCCCCCATTAGCCGGAAATTTAGCTCATACAGGAGCATCTATTGACTTAACAATCTTCTCCCTTCACCTCGCTGGAATTTCATCAATTTTAGGAGCAATTAATTTTATCACAACTATTTTTAATATAAAACCCCCAACTATAACTCAATATCAAACTCCTTTATTTGTTTGATCCGTCCTAATTACTGCAGTCCTTCTCCTATTATCTCTACCAGTACTGGCAGCCGCTATCACAATACTCCTTACAGATCGTAACTTAAATACATCCTTCTTTGACCCTGCGGGGGGAGGAGACCCCATTCTATACCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ichthyomyzon fossor

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 16
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

The Minnesota DNR lists northern brook lamprey as a species of special concern. In order to keep game fish populations high and parasitic sea lamprey populations low, a lampricide treatment is put into streams and rivers where many lamprey, including non-parasitic northern brook lamprey, reside. This lampricide, among other poisons and pollutants, is adversely affecting population size. There is not currently a direct management/conservation plan in place for this species.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
Listed as Least Concern in view of the large extent of occurrence, large number of subpopulations and locations, and probable large population size, and because the species probably is not declining fast enough to qualify for any of the threatened categories.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N3 - Vulnerable

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Environmental Specificity: Narrow. Specialist or community with key requirements common.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is represented by a large number of occurrences (subpopulations). Becker (1983) mapped several dozen collection sites in Wisconsin, representing probably a few dozen distinct occurrences; he stated that the species is probably more widely distributed than present records indicate. Pflieger (1997) mapped 18 collection sites (1945-1995) in three well-isolated river systems in Missouri; he stated that due to identification problems with larvae, the species may be more widely distributed that available records suggest. Burr and Warren (1986) mapped 18 collection sites in several drainages Kentucky; these represent probably about a dozen distinct occurrences, but the species was rated as threatened there. Smith (1979) mapped three collection sites in Illinois all in one river.

Total adult population size is unknown but presumably exceeds 10,000. Rage-wide, this species is locally common (Page and Burr 2011); occasional and uncommon in Kentucky (Burr and Warren 1986); common in at least two river systems in Wisconsin (Becker 1983).

Trend over the past 10 years or three generations is uncertain but probably relatively stable or slowly declining.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable to decline of 30%

Comments: Trend over the past 10 years or three generations is uncertain but probably relatively stable or slowly declining.

Global Long Term Trend: Decline of 50-70%

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
No major threats are known, but the species is vulnerable to local extirpation through indiscriminant use of fish toxicants (Becker 1983).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Degree of Threat: Medium

Comments: No major threats are known, but the species is vulnerable to local extirpation through indiscriminant use of fish toxicants (Becker 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Currently, this species is of relatively low conservation concern and does not require significant additional protection or major management, monitoring, or research action.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Unknown whether any occurrences are appropriately protected and managed

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

There are no known adverse effects of northern brook lamprey on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Although there is little known positive impact of northern brook lamprey on humans, fishermen do occasionally use this species as bait

  • Cumley, R. 1969. Fisherman's Guide to Minnesota Fishes. Houston, Texas: Professional Publication Producers.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Importance

bait: occasionally
  • Scott, W.B. and E.J. Crossman 1973 Freshwater fishes of Canada. Bull. Fish. Res. Board Can. 184:1-966. (Ref. 1998)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Northern Brook Lamprey

The northern brook lamprey (Ichthyomyzon fossor) is a lamprey found in North America throughout the Great Lakes Watershed. There are limited populations within the Mississippi watershed.

Life cycle[edit]

Adults spawn in the spring in the headwaters of streams. The males (aided by females) construct small nests by picking up pebbles with their mouths and moving them to form the rims of shallow depressions. The sticky eggs are deposited in the nest and adhere to the sand and gravel. Multiple adults may spawn in the same nest, and multiple males may spawn with the same female. As with all lamprey adults die after spawning.

When they first hatch embryos remain in the nest for up to one month before they mature into ammocoetes. Ammocoetes leave the nest and seek out slow flowing sandy areas, where they burrow and begin feeding. Ammocoetes live burrowed for 3-7 years, feeding on microscopic plant and animal life and detritus (decaying matter). Mature ammocoetes will begin to metamorphosis in the late summer through the fall.

References[edit]

  • Reighard and Cummins, Description of a new species of lamprey of the genus Ichthyomyzon, 1916
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Ichthyomyzon fossor and I. unicuspis may "represent ecotypes of a single species since, where they are sympatric, they appear to be experiencing ongoing gene flow" (Docker et al. 2012; see also Docker 2009).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!