Overview

Distribution

Range Description

The Common Wombat is endemic to south-eastern Australia, where it has a discontinuous and fragmented range from south-eastern Queensland to south-eastern South Australia on the mainland, and on Flinders Island and Tasmania (McIlroy 2008). It ranges in elevation from sea level to 1,800 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The common wombat inhabits the hilly or mountainous coastal country of southeastern South Australia and as well, Tasmania and Flinders Island in Bass Strait. It used to occupy the other islands of Bass Strait, however, through hunting of humans, it has become extinct. Some zoologists have restricted the range of V. ursinus to Tasmania and Flinders Island and regard the mainland form as a second species, V. hirsutus.

Macdonald (1984), Norwak (1983)

Biogeographic Regions: australian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The common wombat's average body size, from the head to the end of its body, ranges from 700 to 1,200mm. The wombat's tail is a mere stub. The general coloration of the animal varies from yellowish buff, silver gray, light gray, gray, dark brown, or black. Males and females have thick, heavy bodies, small eyes, flattened heads, round ears, and coarse, harsh fur. The common wombat is also equipped with short, powerful legs and long, strong foreclaws for digging their large, often complex burrows. Females have a pouch that opens posteriorly. Nowak (1983), Angus and Robertson (1983)

Range mass: 15 to 35 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is found in temperate forested areas, sclerophyll forest, coastal scrub, and heathland (McIlroy 2008). It is a largely solitary species, that lives in a system of burrows. Breeding can take place at any time of the year, with a single young being born (McIlroy 2008). The young are dependent on the female for at least 17 months. Common Wombats become sexually mature at about two years, and can live up to 11 years in the wild (McIlroy 2008).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Requirements for living include a temperate, humid microclimate, suitable burrowing conditions, and native grasses for food. Slopes above creeks and gullies are favored sites for burrows. They mainly inhabit the wetter, subhumid, eucalypt forests, the hilly, or mountainous coastal country. Macdonald (1984), Nowak (1983)

Terrestrial Biomes: savanna or grassland ; forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The common wombat is herbivorous. It feeds mainly on native grass, roots of shrubs and trees, sedges, matrushes, and fungi, using its forefeet to tear and grasp pieces of vegetation. Some individuals forage among refuse along the seashore. Its teeth are very much like those of rodents. Interestingly enough, the common wombat's teeth have adapted to breaking up its tough, highly fibrous food. Because of this, both upper and lower jaws have a single pair of incissors. These incissors are chisel-like and grow continuously, being kept to a reasonable size by constant wear.

Nowak (1983), Angus and Robertson (1983)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
26.0 years.

Average lifespan

Status: wild:
5.0 years.

Average lifespan

Status: captivity:
26.0 years.

Average lifespan

Status: captivity:
26.1 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 30 years (captivity) Observations: One captive animal was still alive when it was estimated to be at least 30 years old (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

The gestation period of female wombats has been estimated at 20 days. Young appear to be born at any time of the year, but births probably peak in late autumn (April to June in Australia). Females have pouches, like those of kangeroos, in which the young complete their development. As mentioned above, the female's pouch opens posteriorly. The pouch contains two teats; however, the normal liter size is one, although twins are known. Young first leave the pouch at six to seven months, but may return occassionally for three more months. Weaning may not occur until they are 15 months old and sexual maturity is attained after two years. The average lifespan is five years, although this species is capable of a long life span in captivity. The record longevity is 26 years and 1 month.

The major causes of death in wild populations include starvation during droughts, outbreaks of mange, predation by dingoes, and collisions with road vehicles.

Nowak (1983), Angus and Robertson (1983), Macdonald (1984)

Average birth mass: 0.5 g.

Average gestation period: 27 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
730 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
730 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Vombatus ursinus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATTAACCGTTGATTATTCTCAACTAACCACAAAGATATTGGCACCCTGTACCTCTTATTCGGTGCCTGAGCAGGAATAGTAGGGACAGCCCTAAGCCTATTAATTCGAGCAGAATTAGGCCAACCTGGAACCCTCATTGGTGATGACCAAATCTATAATGTCATTGTAAGTGCTCACGCTTTTGTAATAATCTTCTTCATAGTTATGCCTATTATAATTGGAGGCTTCGGTAATTGACTAGTCCCTCTGATAATCGGCGCCCCTGACATAGCATTTCCACGAATAAATAATATAAGTTTCTGGTTACTCCCACCCTCATTCCTCCTCCTACTAGCATCCTCAACAGTAGAAGCGGGGGCAGGAACAGGATGAACTGTATACCCTCCATTAGCTGGAAATATAGCTCATGCTGGCGCATCCGTAGACCTAGCTATTTTGTCCCTACACTTGGCAGGCATTTCCTCAATCCTAGGGGCTATCAACTTTATTACTACCATTATTAACATAAAACCCCCAGCCTTATCCCAATACCAAACTCCCCTATTTGTCTGATCTGTCATAATCACAGCAGTTTTACTCCTTCTATCACTTCCAGTACTAGCCGCAGGTATTACTATACTACTAACAGACCGTAACCTAAACACTACATTCTTTGACCCAGCCGGAGGGGCGGACCCTATCTTATACCAACACTTATTCTGATTTTTTGGCCACCCAGAAGTTTATATTCTCATTCTCCCAGGCTTCGGCATAATTTCACATATCGTAACATACTATTCAGGTAAAAAAGAACCATTTGGCTATATAGGAATAGTATGAGCTATGATATCTATTGGCTTCCTAGGCTTTATTGTATGAGCCCATCATATATTCACAGTAGGACTAGACGTAGACACCCGAGCCTACTTTACCTCTGCTACTATAATTATTGCAATCCCAACAGGAGTTAAAGTTTTTAGCTGATTAGCCACACTCCATGGTGGGAATATTAAATGATCCCCAGCAATACTATGAGCACTAGGCTTTATCTTCCTCTTCACTATTGGCGGTCTAACAGGAATTGTCCTAGCCAACTCATCCCTAGACATCGTTCTCCATGACACTTACTATGTAGTAGCACATTTTCACTACGTGCTTTCAATAGGAGCCGTTTTCGCAATTATAGGAGGATTCGTTCACTGATTCCCTCTATTTACAGGGTACACACTTAACGACACATGAGCTAAAATTCACTTCTCTGTAATATTTGTAGGGGTTAACCTCACATTCTTCCCACAACACTTCCTAGGCCTCTCTGGTATGCCACGACGATATTCAGACTACCCAGATGCTTACACACTATGAAACGTATTATCATCAATTGGCTCCTTCATTTCACTCACAGCTGTCATCCTGATAGTATTCATTGTTTGAGAAGCCTTCGCATCAAAACGTGAAGTCTTAACTGTAGAACTAACAACTACTAACATTGAATGACTCTATGGTTGTCCACCACCTTACCACACATTCGAACAACCAGTATTCGTAAAAACCTAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Vombatus ursinus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Taggart, D., Martin, R. & Menkhorst, P.

Reviewer/s
Lamoreux, J. & Hilton-Taylor, C. (Global Mammal Assessment Team)

Justification
Listed as Least Concern as the species is common, has a wide distribution, tolerates a broad range of habitats, and because it is unlikely to be undergoing a decline in population.

History
  • 1996
    Lower Risk/least concern
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The decline of the common wombat has resulted from humans exterminating them, hunting for sport, and competition for food with rabbits. Each species of wombat is protected to some degree in the different states in Australia, except in Victoria, where they are still threatened by hunting. Nowak (1983)

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is common.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There appear to be no major threats to this species. It has historically declined through conversion of native vegetation to agricultural land, and may continue to be threatened by this in parts of its range. Individual animals may be killed by feral dogs and by road vehicles. Populations at the fringes of the range are susceptible to sarcoptic mange.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is present in some protected areas. It is protected in most states except for eastern Victoria where it is classed as vermin, mainly because of the damage it causes to fencing.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

The common wombat is classed as vermin in eastern Victoria, mainly because of its damage to rabbit proof fences. Many times the common wombat's burrows pass under rabbit proof fences, which allows rabbits to get around those fences. This is a major nuisance to people who wish to either keep rabbits in the fence or keep them out of the enclosed area. Also, the openings of the wombat's burrows are hazardous to large livestock.

Angus and Robertson (1983), Macdonald (1984)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

In 1965 the common wombat was wildly hunted because its fur had commercial importance. Recently it has been hunted for sport. Angus and Robertson (1983)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Common wombat

The common wombat (Vombatus ursinus), also known as the coarse-haired wombat or bare-nosed wombat, is a marsupial, one of three species of wombats and the only one in the genus Vombatus. The common wombat grows to an average of 98 cm (39 in) long and a weight of 26 kg (57 lb).

Contents

Taxonomy

1807 illustration of the now extinct wombats of King Island

The common wombat was first described by George Shaw in 1800. Three subspecies are noted, though their distinctness is somewhat uncertain:

Distribution

Common wombat in Narawntapu National Park, Tasmania

It is widespread in the cooler and better watered parts of southern and eastern Australia, including Tasmania, and in mountain districts as far north as the south of Queensland, but is declining in Western Victoria and South Australia.

Description

Common wombats are sturdy and built close to the ground. When fully grown, they can reach between 80 and 130 cm, and weigh between 17 and 40 kg. The wombats found on Tasmania and Flinders Island are often smaller than their mainland counterparts. It is distinguished from both hairy-nosed wombats by its bald nose.

Behaviour

Common wombats are a solitary, territorial species, with each wombat having an established range in which it lives and feeds. In this area, they dig a tunnel system, with tunnels ranging anywhere from 2 to 20 metres in length, along with many sidetunnels. There is usually only one entrance to the burrow, although they may create a smaller one to escape with. Often nocturnal, the common wombat does come out during the day in cooler weather, such as in early morning or late afternoon.[7]

Diet

Common wombats are herbivorous, subsisting off grass, snow tussocks and other plant materials. Foraging is usually done during the night.[7]

Breeding

The common wombat can breed every two years and produce a single joey. The gestation period is about 20-30 days, and the young remain in the pouch for five months. When leaving the pouch, they weigh between 3.5 and 6.5 kg (7.7 and 14 lb). The joey is weaned at around 12 to 15 months of age, and is usually independent at 18 months of age.[7] Wombats have an average lifespan of 15 years in the wild and 20 years in captivity.

References

  1. ^ Groves, C. P. (2005). In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 43–44. OCLC 62265494. ISBN 0-801-88221-4. 
  2. ^ Taggart, D., Martin, R. & Menkhorst, P. (2008). Vombatus ursinus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 28 December 2008. Database entry includes justification for why this species is of least concern
  3. ^ a b c "Common Wombat". Department of Primary Industries, Parks, Water and Environment. Retrieved 13 December 2009. 
  4. ^ "Common Wombat". Wombania's Wombat Information Center. Retrieved 13 December 2009. 
  5. ^ Vombatus ursinus ursinus — Common Wombat (Bass Strait)
  6. ^ Australasian Marsupial & Monotreme Specialist Group (1996). {{{title}}}. 2006. IUCN Red List of Threatened Species. IUCN 2006. www.iucnredlist.org. Retrieved on 15 March 2007.
  7. ^ a b c "Wombats, Wombat Pictures, Wombat Facts". National Geographic Society. Retrieved 21 July 2011. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!