Overview

Distribution

Wombats are native to the Australian biogeographic region. Coarse-haired wombats are found along the eastern edge of Queensland and New South Whales, in addition to Victoria, Flinder's Island, Tasmania, and parts of South Australia.

Biogeographic Regions: australian (Native )

  • 2011. "Vombatus ursinus" (On-line). Encyclopedia of Life. Accessed February 24, 2012 at http://eol.org/pages/981577/details.
  • Paris, M., A. White, A. Reiss, M. West, F. Schwarzenberger. 2002. Faecal progesterone metabolites and behavioural observations for the non-invasive assessment of oestrous cycles in the common wombat (Vombatus ursinus) and the southern hairy-nosed wombat (Lasiorhinus latifrons).. Animal Reproduction Science, 72, no. 3/4: 245.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

The Common Wombat is endemic to south-eastern Australia, where it has a discontinuous and fragmented range from south-eastern Queensland to south-eastern South Australia on the mainland, and on Flinders Island and Tasmania (McIlroy 2008). It ranges in elevation from sea level to 1,800 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Coarse-haired wombats are large, squat, thick-set grazers with a broad, rounded head, stubby tail, small dark eyes, and small round ears. Its limbs are short with sturdy claws for burrowing. Wombats have a pair of rootless, ever-growing incisors differs them from marsupials and can be used for cutting through obstacles when burrowing. Its fur is thick and coarse and can range in color from grey-brown to blackish, patchy grey and buff, or uniformly cream colored. Unlike the two other species of wombat, this species lacks hair on its rhinarium, and the ears are smaller and more furred than that of its close relatives. The northern and southern hairy nosed wombats tend toward longer muzzles that are more square-like in shape. Populations of coarse-haired wombats that inhabit Tasmania tend to have smaller members than the mainland, and Flinders Island populations have the smallest members.

Range mass: 20 to 35 kg.

Range length: 700 to 1100 mm.

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Coarse-haired wombats inhabit temperate areas with suitable burrowing conditions, which may include areas such as open forests, heathlands, and hilly coastal scrub.

Range elevation: 0 to 1800 m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest ; scrub forest

Other Habitat Features: riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
It is found in temperate forested areas, sclerophyll forest, coastal scrub, and heathland (McIlroy 2008). It is a largely solitary species, that lives in a system of burrows. Breeding can take place at any time of the year, with a single young being born (McIlroy 2008). The young are dependent on the female for at least 17 months. Common Wombats become sexually mature at about two years, and can live up to 11 years in the wild (McIlroy 2008).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

The combination of low metabolic activity and a large digestive tract allows wombats to utilize areas where the vegetation may be of poor quality. The common wombat is a folivore, with a diet that consists of native grasses, sedges, moss, and sometimes shrubs, roots, tubers, and bark. The small, acidic stomach and simple small intestine of wombats digests plant cell material, while the hind gut houses microbial fermentation, with which wombats digest the fibrous cell walls of plants. The hind gut consists of a proximal colon (which makes up roughly 60 to 80% of gut contents), a cecum, and the distal colon. Some of the plant species in the wombat diet include Poa, Themeda australis, Carex appressa, Juncas, Stipa, and Danthonia penicillata.

Plant Foods: leaves; roots and tubers; wood, bark, or stems; bryophytes

Primary Diet: herbivore (Folivore )

  • 1993. Digestive Strategies of the Wombats: Feed Intake, Fiber Digestion, and Digesta Passage in Two Grazing Marsupials with Hindgut Fermentation. Physiological Zoology, Vol. 66, No. 6: pp. 983-999. Accessed February 21, 2012 at http://www.jstor.org/stable/30163750.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Wombats often live in riparian environments, due to their preference to build burrows above creeks and streams. Due to their grazing and soil-displacing habits, wombats may help to provide different microsites that influence vegetative growth patterns in these environments.

Ecosystem Impact: creates habitat

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predators of the common wombat include Tasmanian devils, dogs, wedge-tailed eagles, and humans. Prior to their extinction, Tasmanian wolves probably preyed on the wombats, as well. The combination of low metabolic rate and efficient digestion allows wombats to spend much of their time in their burrows away from predators, though wombats likely have these traits to exploit a diet of poor-quality vegetation and not to avoid predation. Wombats sometimes build dirt plugs to close off their tunnels, which may be a defensive behavior.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

The common wombat communicates to conspecifics in a number of ways, mainly through scent marking to maintain territories. Other forms of communication include vocalizations, aggresive displays, and markings on logs and branches made by rubbing against them repeatedly.

Communication Channels: visual ; acoustic ; chemical

Other Communication Modes: scent marks

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

There are few studies describing wombat longevity; however, the longest a wombat lived in captivity was approximately 30 years. They typically only live 12 to 15 years.

Range lifespan

Status: captivity:
30 (high) years.

Typical lifespan

Status: wild:
12 to 15 years.

Average lifespan

Status: captivity:
26.0 years.

Average lifespan

Status: captivity:
26.1 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 30 years (captivity) Observations: One captive animal was still alive when it was estimated to be at least 30 years old (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Coarse-haired wombats reproductive behavior consists of a male chasing the female in circles for several minutes at a time until the female slows down enough for him to catch up. At this point he bites her rump, grasps her with his forelegs, and flips her onto her side. The male then mounts her while laying on his side; after which the female may break off into a jog, and the chasing behavior ensues again. These sessions may last about 30 minutes. Not much is known about wombat mating systems, but there is some evidence to suggest that they are polygynous.

Mating System: polygynous

Coarse-haired wombats typically breed and produce one offspring about every two years. Their breeding doesn't seem to be tied to any particular season, though births may be clustered in summer. Gestation lasts approximately one month, producing a tiny joey about the size of a jelly bean. This joey grows in the pouch until it is weaned at approximately 12 months of age. Both male and female wombats are sexually mature after about 2 years.

Breeding interval: Common wombats breed about once every two years.

Breeding season: Reproduction is not strongly linked to seasons.

Average number of offspring: 1.

Range gestation period: 27 to 31 days.

Range weaning age: 12 to 20 months.

Range time to independence: 18 to 20 months.

Average age at sexual or reproductive maturity (female): 2 years.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; viviparous

Average birth mass: 0.5 g.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
730 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
730 days.

After birth, the wombat joey will live in its mother's pouch for about 6 months, feeding off the mothers milk until about 15 months of age. The wombat will remain with its mother until about 18 to 20 months of age, until it gains its independence.

Parental Investment: altricial ; female parental care ; pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

  • 2009. "Common Wombat" (On-line). Accessed February 21, 2012 at http://www.dpiw.tas.gov.au/inter.nsf/webpages/bhan-53f7kj?open.
  • Banks, S., L. Skerratt, A. Taylor. 2002. Female dispersal and relatedness structure in common wombats (Vombatus ursinus). Journal of Zoology, 256: 389–399.
  • Barnes, M. 2005. "Husbandry Manual for Common Wombat" (On-line). Accessed April 02, 2012 at http://www.fourthcrossingwildlife.com/CommonWombatHusbandryManual-MicheleBarnes.pdf.
  • Jackson, S. 2003. Australian Mammals Biology and Captive Management. Collingwood VIC 3066: Csiro Publishing.
  • Menkhorst, P., F. Knight. 2011. A Field Guide to the Mammals of Australia. Oxford, New York: Oxford University Press.
  • Paris, M., A. White, A. Reiss, M. West, F. Schwarzenberger. 2002. Faecal progesterone metabolites and behavioural observations for the non-invasive assessment of oestrous cycles in the common wombat (Vombatus ursinus) and the southern hairy-nosed wombat (Lasiorhinus latifrons).. Animal Reproduction Science, 72, no. 3/4: 245.
  • Skerratt, L., J. Skerratt, S. Banks, R. Martin, K. Handasyde. 2004. Aspects of the ecology of common wombats (Vombatus ursinus) at high density on pastoral land in Victoria. Australian journal of zoology, 52/3: 303-330.
  • de Magalhaes, J., J. Costa. 2009. "A database of vertebrate longevity records and their relation to other life-history traits" (On-line). Accessed February 21, 2012 at http://genomics.senescence.info/species/entry.php?species=Vombatus_ursinus.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Vombatus ursinus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATTAACCGTTGATTATTCTCAACTAACCACAAAGATATTGGCACCCTGTACCTCTTATTCGGTGCCTGAGCAGGAATAGTAGGGACAGCCCTAAGCCTATTAATTCGAGCAGAATTAGGCCAACCTGGAACCCTCATTGGTGATGACCAAATCTATAATGTCATTGTAAGTGCTCACGCTTTTGTAATAATCTTCTTCATAGTTATGCCTATTATAATTGGAGGCTTCGGTAATTGACTAGTCCCTCTGATAATCGGCGCCCCTGACATAGCATTTCCACGAATAAATAATATAAGTTTCTGGTTACTCCCACCCTCATTCCTCCTCCTACTAGCATCCTCAACAGTAGAAGCGGGGGCAGGAACAGGATGAACTGTATACCCTCCATTAGCTGGAAATATAGCTCATGCTGGCGCATCCGTAGACCTAGCTATTTTGTCCCTACACTTGGCAGGCATTTCCTCAATCCTAGGGGCTATCAACTTTATTACTACCATTATTAACATAAAACCCCCAGCCTTATCCCAATACCAAACTCCCCTATTTGTCTGATCTGTCATAATCACAGCAGTTTTACTCCTTCTATCACTTCCAGTACTAGCCGCAGGTATTACTATACTACTAACAGACCGTAACCTAAACACTACATTCTTTGACCCAGCCGGAGGGGCGGACCCTATCTTATACCAACACTTATTCTGATTTTTTGGCCACCCAGAAGTTTATATTCTCATTCTCCCAGGCTTCGGCATAATTTCACATATCGTAACATACTATTCAGGTAAAAAAGAACCATTTGGCTATATAGGAATAGTATGAGCTATGATATCTATTGGCTTCCTAGGCTTTATTGTATGAGCCCATCATATATTCACAGTAGGACTAGACGTAGACACCCGAGCCTACTTTACCTCTGCTACTATAATTATTGCAATCCCAACAGGAGTTAAAGTTTTTAGCTGATTAGCCACACTCCATGGTGGGAATATTAAATGATCCCCAGCAATACTATGAGCACTAGGCTTTATCTTCCTCTTCACTATTGGCGGTCTAACAGGAATTGTCCTAGCCAACTCATCCCTAGACATCGTTCTCCATGACACTTACTATGTAGTAGCACATTTTCACTACGTGCTTTCAATAGGAGCCGTTTTCGCAATTATAGGAGGATTCGTTCACTGATTCCCTCTATTTACAGGGTACACACTTAACGACACATGAGCTAAAATTCACTTCTCTGTAATATTTGTAGGGGTTAACCTCACATTCTTCCCACAACACTTCCTAGGCCTCTCTGGTATGCCACGACGATATTCAGACTACCCAGATGCTTACACACTATGAAACGTATTATCATCAATTGGCTCCTTCATTTCACTCACAGCTGTCATCCTGATAGTATTCATTGTTTGAGAAGCCTTCGCATCAAAACGTGAAGTCTTAACTGTAGAACTAACAACTACTAACATTGAATGACTCTATGGTTGTCCACCACCTTACCACACATTCGAACAACCAGTATTCGTAAAAACCTAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Vombatus ursinus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

According the the IUCN Red List for Threatened Species, coarse-haired wombats are listed as least concern, and the population trends are currently stable. They are protected in all states of Australia.

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Taggart, D., Martin, R. & Menkhorst, P.

Reviewer/s
Lamoreux, J. & Hilton-Taylor, C. (Global Mammal Assessment Team)

Contributor/s

Justification
Listed as Least Concern as the species is common, has a wide distribution, tolerates a broad range of habitats, and because it is unlikely to be undergoing a decline in population.

History
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is common.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There appear to be no major threats to this species. It has historically declined through conversion of native vegetation to agricultural land, and may continue to be threatened by this in parts of its range. Individual animals may be killed by feral dogs and by road vehicles. Populations at the fringes of the range are susceptible to sarcoptic mange.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is present in some protected areas. It is protected in most states except for eastern Victoria where it is classed as vermin, mainly because of the damage it causes to fencing.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Wombats are sometimes seen as pests in areas of farming due to their burrowing behavior creating hazards for livestock. Also, wombats sometimes burrow under rabbit fences, allowing rabbits an escape path.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wombats were hunted for their pelts; now they are protected and it is illegal.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Common wombat

The common wombat (Vombatus ursinus), also known as the coarse-haired wombat or bare-nosed wombat, is a marsupial, one of three species of wombats and the only one in the genus Vombatus. The common wombat grows to an average of 98 cm (39 in) long and a weight of 26 kg (57 lb).

Taxonomy[edit]

1807 illustration of the now extinct wombats of King Island

The common wombat was first described by George Shaw in 1800. Three subspecies are noted, though their distinctness is somewhat uncertain:

Distribution and Habitat[edit]

Common wombat in Narawntapu National Park, Tasmania

It is widespread in the cooler and better watered parts of southern and eastern Australia, including Tasmania, and in mountain districts as far north as the south of Queensland, but is declining in Western Victoria and South Australia.

Common wombats can be found at any elevation in the south of their range, however in the north of their range are only found in higher, more mountainous areas. They may be found in a variety of habitats including rainforest, eucalyptus forest, woodland, alpine grassland and coastal areas. In some regions they have adapted to farmland and can even be seen grazing in open fields with cattle and sheep.

Description[edit]

Common wombats are sturdy and built close to the ground. When fully grown, they can reach between 80 and 130 cm, and weigh between 17 and 40 kg. The wombats found on Tasmania and Flinders Island are often smaller than their mainland counterparts. It is distinguished from both hairy-nosed wombats by its bald nose.

Behaviour[edit]

Common wombats are a solitary, territorial species, with each wombat having an established range in which it lives and feeds. In this area, they dig a tunnel system, with tunnels ranging anywhere from 2 to 20 metres in length, along with many sidetunnels. There is usually only one entrance to the burrow, although they may create a smaller one to escape with. Often nocturnal, the common wombat does come out during the day in cooler weather, such as in early morning or late afternoon.[7]

Diet[edit]

Common wombats are herbivorous, subsisting off grass, snow tussocks and other plant materials. Foraging is usually done during the night.[7]

Breeding[edit]

The common wombat can breed every two years and produce a single joey. The gestation period is about 20-30 days, and the young remain in the pouch for five months. When leaving the pouch, they weigh between 3.5 and 6.5 kg (7.7 and 14.3 lb). The joey is weaned at around 12 to 15 months of age, and is usually independent at 18 months of age.[7] Wombats have an average lifespan of 15 years in the wild and 20 years in captivity.

References[edit]

  1. ^ Groves, C. P. (2005). Wilson, D. E.; Reeder, D. M, eds. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 43–44. OCLC 62265494. ISBN 0-801-88221-4. 
  2. ^ Taggart, D., Martin, R. & Menkhorst, P. (2008). Vombatus ursinus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 28 December 2008. Database entry includes justification for why this species is of least concern
  3. ^ a b c "Common Wombat". Department of Primary Industries, Parks, Water and Environment. Retrieved 13 December 2009. 
  4. ^ "Common Wombat". Wombania's Wombat Information Center. Retrieved 13 December 2009. 
  5. ^ Vombatus ursinus ursinus — Common Wombat (Bass Strait)
  6. ^ Australasian Marsupial & Monotreme Specialist Group (1996). Vombatus ursinus ssp. ursinus. 2006. IUCN Red List of Threatened Species. IUCN 2006. www.iucnredlist.org. Retrieved on 15 March 2007.
  7. ^ a b c "Wombats, Wombat Pictures, Wombat Facts". National Geographic Society. Retrieved 21 July 2011. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!