Overview

Distribution

Range Description

This species is confined to a few areas in far northeastern Viet Nam (Groves 2001). Historically limited to areas east of the Red River (Nadler et al. 2003), its distribution has become dramatically restricted in recent decades due to massive deforestation and intensive hunting (Nadler et al. 2003). It is currently known only from small forest patches in Tuyen Quang and Bac Kan Provinces, and to a lesser extent in Ha Giang and Thai Nguyen Provinces (Nadler et al. 2003).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Vietnam

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is found in tropical evergreen forests associated with karst limestone hills and mountains (Le and Boonratana 2006), and is largely restricted to primary forest (Boonratana and Canh 1998). It has been recorded at elevations between 200 and 1,200 m (Le and Boonratana 2006). Ranges of different groups overlap greatly (Boonratana and Canh 1998). It appears to be a selective feeder, feeding on the young leaves, unripe fruits, and seeds of as many as 52 plant species (Boonratana and Canh 1998). These animals are diurnal (Nguyen 2000), and arboreal and terrestrial.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Rhinopithecus avunculus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGCTCATTAACCGCTGGCTATTCTCCACAAATCATAAAGATATTGGAACTTTATACTTACTATTTGGCGCATGGGCCGGAACCATAGGTATGGCTATAAGTCTTCTTATTCGAGCTGAACTAGGTCAACCCGGCAACCTATTAGGCAATGATCACATTTATAATGTTATCGTTACAGCCCATGCATTTGTTATAATTTTCTTTATAGTTATACCTATTATAATTGGAGGTTTCGGAAATTGACTAGTACCCTTAATAATTGGCGCTCCTGACATAGCATTTCCTCGTCTAAATAATATAAGCTTCTGACTTCTTCCACCATCTTTTCTACTTCTTCTTGCATCAGCCATAGTAGAGGCTGGTGCCGGGACAGGCTGAACAGTTTACCCGCCTCTAGCGGGAAACCTCTCTCACCCAGGGGCCTCTGTAGATTTAACTATTTTCTCACTACACCTAGCAGGTATTTCTTCTATTCTAGGGGCTATTAATTTCATCACAACTATTATTAATATAAAACCTCCTGCTATGTCTCAATATCAAACCCCCCTATTTGTTTGATCAGTTCTAATTACAGCAGTCCTATTACTCCTATCCCTGCCTGTATTAGCTGCAGGTATTACAATACTATTAACAGACCGTAACCTCAACACTACATTCTTTGACCCCGCCGGAGGAGGAGATCCGATCTTATATCAACACCTATTCTGATTTTTCGGTCACCCTGAAGTCTACATTCTTATTTTACCTGGCTTTGGAATAATTTCACACATCGTAACATATTACTCTGGAAAAAAAGAACCTTTCGGGTACATGGGCATAGTCTGAGCTATAGTATCAATTGGGTTTTTAGGTTTTATCGTATGAGCCCACCATATATTTACCGTTGGTATAGACGTAGATACACGAGCCTATTTTACCTCTGCCACTATGATTATTGCAATTCCAACTGGCGTCAAAGTCTTTAGCTGACTCGCTACACTACACGGAGGAAATATTAAATGATCTCCAGCAATACTCTGAGCCCTAGGCTTTATTTTCCTTTTTACCGTAGGGGGCTTAACTGGTATTGTACTAGCAAATTCATCACTAGATATCGTATTACATGATACATACTATGTTGTAGCTCATTTCCACTACGTCTTATCAATAGGAGCTGTCTTTGCTATTATAGGAGGCTTTATTCACTGATTCCCCCTATTCTCGGGCTATACCCTAGACCAAGTCTGTGCCAAAGCACATTTTATTATTATGTTTGTAGGTGTAAATTTAACCTTCTTCCCACAACATTTCCTTGGCTTATCCGGAATACCCCGACGCTATTCCGATTACCCTGATGCCTACACCACATGAAATATCGTGTCATCCATAGGCTCCTTTATTTCTCTAGTAGCTATACTACTAATAGTCTATATAATCTGAGAAGCTTTTGCCTCGAAACGTAAGGTTCTATTAATCGAACAACCTACGTCTAATCTAGAATGACTACATGGCTCCCCACCACCATACCACACATTTGATGAACCAGCATTCATTAAAGTAATATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Rhinopithecus avunculus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
C2a(i)

Version
3.1

Year Assessed
2008

Assessor/s
Xuan Canh, L., Khac Quyet, L., Thanh Hai, D. & Boonratana, R.

Reviewer/s
Mittermeier, R.A. & Rylands, A.B. (Primate Red List Authority)

Contributor/s

Justification
Listed as Critically Endangered because its population size is estimated to number fewer than 250 mature individuals, with no subpopulation greater than 50 mature individuals, and it is experiencing a continuing decline.

History
  • 2003
    Critically Endangered
    (IUCN 2003)
  • 2000
    Critically Endangered
  • 1996
    Critically Endangered
    (Baillie and Groombridge 1996)
  • 1994
    Endangered
    (Groombridge 1994)
  • 1990
    Endangered
    (IUCN 1990)
  • 1988
    Endangered
    (IUCN Conservation Monitoring Centre 1988)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 10/19/1976
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Rhinopithecus avunculus , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is endemic to northern Viet Nam, and very rare (Nguyen 2000). A study of the Tat Ke Sector of the Na Hang Nature Reserve in 1993 estimated a density of less than 8 individuals/km2 (Le and Boonratana 2006); a later study, in 2004-2005, found far lower densities. It has been suggested that hunting pressure is the reason for low densities in Tat Ke Sector, and former densities may have reached 20 individuals/km2 (Le and Boonratana 2006). The highest estimate for any one population was in the Ban Bung sector of the Na Hang Nature Reserve, at between 90 and 110 individuals in 1992 (Ratajszczak et al. 1992). There is a suggested trend of decline in both sectors of the Na Hang Nature Reserve, Tat Ke and Ban Bung (Le and Boonratana 2006). There are estimated to be about 250 individuals throughout its known range, though the global population could actually be higher, due to the possible occurrence of this species in other areas where it has not yet been recorded (Le and Boonratana 2006).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
These animals are reported as threatened from habitat degradation and hunting pressure. There is an increase in habitat disturbance from humans in the southern sectors of the Na Hang Nature Reserve. They are not shy and do not necessarily flee when encountered by humans, increasing the chance of being shot (Nguyen 2000). Hunting is the most immediate threat to this species (Nadler et al. 2003), despite claims from various sources that it is not hunted. The only reason more individuals are not shot is due to the rarity of the species, and not because of law enforcement or awareness of the species importance (Long and Le Khac Quyet 2001).

Although this species is not usually targeted for bushmeat hunting due to its "foul-taste", it is shot when encountered, and consumed or used in traditional "medicine" (Le and Boonratana 2006; Nadler et al. 2003). It has been found in trade in China, where it may be used for "medicinal" purposes (Nadler pers. comm.), although this is likely to be limited. There is a high hunting pressure in the area where it lives, as evidenced by several gunshots heard almost daily during field trips (2004-2005) in the Na Hang Nature Reserve (Le and Boonratana 2006). Shifting and settled cultivation, as well as other land development activities, also pose a threat (Le and Boonratana 2006; Nadler et al. 2003). In the past, excessively intense and unsustainable legal and illegal logging and gold mining were the biggest threats. Recently, the development of a hydroelectric power project along the Gam River in Na Hang has caused large areas of its habitat to come under construction (Le and Boonratana 2006; Nadler et al. 2003). Also, sudden increases in human populations, especially construction workers, have led to increased demand for meat, and thus increased hunting pressure (Le and Boonratana 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed on CITES Appendix I. It is confirmed as occurring in two protected areas: Na Hang Nature Reserve and Cham Chu Nature Reserve (Le and Boonratana 2006), and may occur in others (M. Richardson pers. comm.). Based on interviews and specimen information, it may occur in Yen Tu Nature Reserve in Quang Ninh Province, but it is unclear whether a population survives (Le Khac Quyet pers. comm.).

Nadler et al (2003) recommended the following conservation actions to preserve this species in Viet Nam: undertaking of further field status surveys; expansion of the protected area network and improvement of protected area management; mitigation of impacts from dam construction; and other options for conservation, including assessments of its behavior, diet, and ecological relationships in order to support a captive breeding program, and planning for subsequent release into a suitably designed, well-protected natural areas which can support it. Subsequent to these recommendations, the results of a stakeholder consensus workshop proposed: establishment of a species and habitat protection program; long-term monitoring program; long-term field studies on behavioral ecology; surveys; expansion of protected habitats; strengthening of protected area management; public awareness and conservation education; participation of stakeholder communities; relocation of stakeholder communities; and implementation of recommendations (Le and Boonratana 2006).

An important conservation measure is the establishment of a species habitat/conservation area for Khau Ca Conservation Area in Ha Giang Province. Strict law enforcement is needed wherever the species still survives (Boonratana and Le 1998).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Tonkin snub-nosed monkey

The Tonkin snub-nosed monkey or Dollman's snub-nosed monkey (Rhinopithecus avunculus) is a critically endangered, slender-bodied arboreal colobine, endemic to northern Vietnam. Recorded at elevations between 200 to 1,200 m, its distribution is currently restricted to small fragmented tropical evergreen forests associated with steep karst limestone hills and mountains. Five isolated extant populations have been identified since its rediscovery in 1992. [3]Despite heralded as a flagship species and subsequently receiving international attention and conservation actions, the population trend remains on the decline; therefore causing it to be continuously listed as one of "The World's 25 Most Endangered Primates."[4][5] since the first global non-human primate biennial assessment began in 2001.

Habitat loss and hunting are some of the major causes for declines of naturally occurring populations of non-human primates, including the Tonkin Snub-nosed monkey. Decades of expanding human population and increasing demands for scarce agriculturally viable lands have led to the loss and fragmentation of the monkey’s habitats. However, habitats of known Tonkin snub-nosed monkey populations were long lost and fragmented prior to their rediscovery. A pioneering study in 1993, in Na Hang Nature Reserve, obtained a population count of 72 individuals (estimated 80), and a subsequent study at the same site in 2005 obtained a population count of 17 individuals (estimated 22). Evidenced by both primary and secondary data, the population decline within that 13-year period can only be attributed to hunting activities.[3]

Sightings of the monkey have become increasingly rare. The primate was thought to be extinct until the 1990s, when a small population was discovered in Na Hang District in Tuyen Quang Province of Vietnam. Heavy poaching for food as well as the wildlife blackmarket and the destruction of habitat are the main reasons why the Tonkin snub-nosed monkey is considered to be one of[clarification needed]. By 2008, when a small population with three infants was discovered in a remote forest, fewer than 250 of the primates were thought to exist.[6]

Biology

The Tonkin snub-nosed monkey is diurnal and its diet consists of a range of leaves, fruits, flowers and seeds. Detailed information on this species can be found on Arkive.org and Alltheworldsprimates.org

References

  1. ^ Groves, C. P. (2005). In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press. p. 173. OCLC 62265494. ISBN 0-801-88221-4. 
  2. ^ Xuan Canh, L., Khac Quyet, L., Thanh Hai, D. & Boonratana, R. (2008). Rhinopithecus avunculus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 5 November 2008.
  3. ^ a b Ramesh, Boonratana (18-22 March 2013). "The Tonkin Snub-nosed monkey of Vietnam: a singking flagship?". ATBC Asia-Pacific Chapter, Banda Aceh. 
  4. ^ Mittermeier, R.A.; Wallis, J.; Rylands, A.B.; Ganzhorn, J.U.; Oates, J.F.; Williamson, E.A.; Palacios, E.; Heymann, E.W.; Kierulff, M.C.M.; Long Yongcheng; Supriatna, J.; Roos, C.; Walker, S.; Cortés-Ortiz, L.; Schwitzer, C., eds. (2009). Primates in Peril: The World's 25 Most Endangered Primates 2008–2010 (PDF). Illustrated by S.D. Nash. Arlington, VA.: IUCN/SSC Primate Specialist Group (PSG), International Primatological Society (IPS), and Conservation International (CI). pp. 1–92. ISBN 978-1-934151-34-1. 
  5. ^ snub nosed monkeys
  6. ^ (BBC News) "Glimmer of hope for rare monkey", 7 December 2008.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!