Overview

Comprehensive Description

Comprehensive Description

The Asian Longhorned Beetle (Anoplophora glabripennis) is native to eastern China, Japan, and Korea. However, it has now been accidentally introduced to the United States, where it was first discovered in 1996, as well as Canada and several countries in Europe, including Austria, France, Germany, and Italy. Individuals have been intercepted in warehouses across the United States. Outbreaks of this beetle pose a severe threat to even perfectly healthy trees in both forests and urban and suburban landscapes. A closely related species, A. chinensis, is considered one of the most destructive longhorned beetles in the world (and the longhorned beetles in general are among the most economically important pests of hardwood trees). Anoplophora glabripennis attacks a variety of tree species, including maples (Acer), willows (Salix), poplars (Populus), birches (Betula), elms (Ulmus), and horse chestnuts (Aesculus), among others. Early instar larvae feed beneath the bark of host trees, destroying the cambial tissue; late instar larvae weaken trees by feeding in both sapwood and heartwood, where numerous larval tunnels often result in tree breakage and death. Larvae bore into the main trunk, branches, and exposed roots of both young and old trees. This beetle is believed to have spread out of Asia in solid wood packaging material. (Cavey et al. 1998; Nowak et al. 2001 and references therein; Smith et al. 2001; Hu et al. 2009)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Distribution

Geographic Range

Anoplophora glabripennis are indigenous to China and Korea. Between 1994 and 1996 they were introduced to the greater areas of New York and Chicago through commercial trade. Today, these beetles are found throughout warehouses in Alabama, California, Florida, Illinois, Indiana, Michigan, New Jersey, New York, North Carolina, Ohio, Pennsylvania, South Carolina, Texas, Washington, and Wisconsin.

Biogeographic Regions: nearctic (Introduced ); palearctic (Introduced , Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Adult Anoplophora glabripennis are between 20 and 35 mm long, and 7 and 12 mm wide. Their bodies are glossy black with approximately 20 white spots on each wing cover. The antennae of male beetles are 1.5 times as long as their bodies, and the antennae of female beetles are 1.3 times as long as their bodies. The antennae of both sexes are striped black and white. The upper sections of the legs of the adults are whitish-blue. Anoplophora glabripennis can be distinguished from related species by the markings on the wing covers and the pattern of the antennae.

Larvae can reach to 50 mm in length. They are elongated and cylindrical in shape, pale in color and have a varied texture on the underside.

Range length: 20 to 35 mm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes shaped differently

  • Frank, P. February 2001. The Asian longhorned beetle. New York State Conservationist, Vol. 55, No. 4: 19-21.
  • Cavey, J. February 8, 2000. "*Anoplophora glabripennis* (Motschulsky)" (On-line). Accessed March 19, 2002 at http://www.exoticforestpests.org/english/Detail.CFM?tblEntry__PestID=53.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Look Alikes

Lookalikes

Cavey et al. (1998) discuss the discrimination of A. glabripennis larvae from those of other species with which they could possibly be confused in North America.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat

Asian long-horned beetles inhabit areas with hardwood (warehouses) and hardwood forests. They are found terrestrially throughout temperate zones of Eastern Asia and parts of the United States living in various species of hardwood trees.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest

Other Habitat Features: urban ; suburban ; agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dispersal

Dispersal

Although individuals do not typically disperse very far, some may travel as far as a kilometer or two in a season in search of new host trees (Hu et al. 2009).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Adult Anoplophora glabripennis are herbivorous feeding on leaves, twigs, and other plant matter. In their native habitat juvenile A. glabripennis feed on the healthy bark, phloem, and xylem of more than 24 species of hardwood trees, particulary species of poplar. In the United States, the beetles feed on birch, chestnut, green ash, maple, and a variety of other trees.

Plant Foods: wood, bark, or stems; sap or other plant fluids

Primary Diet: herbivore (Lignivore, Eats sap or other plant foods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Asian long-horned beetles are detrimental to any ecosystem they inhabit. In China, approximately 40% of poplar plantations have been damaged, meaning the wood is good only for packing material. In the Ningxia Province of China, more than 50 million trees were destroyed over a three-year period because of the beetles. These beetles have the ability to significantly alter the composition of North American hardwood forests. It is estimated that between nearly one-third of all trees would have to be destroyed in the United States if A. glabripennis were to spread throughout the country. The potential for widespread distribution in North America and the attack of a wide range of host trees is also very possible.

Ecosystem Impact: biodegradation ; parasite

Species Used as Host:

  • various species of trees particularly poplars and maples

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Aside from being able to fly away from predators, asian long-horned beetles do not have any documented anti-predator adaptions.

Known Predators:

  • Smith, M. June 1999. "The Potential For Biological Control of Asian Longhorned Beetle in the U.S." (On-line). Accessed March 20, 2002 at http://www.entomology.wisc.edu/mbcn/fea606.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Communication Channels: visual ; chemical

Other Communication Modes: pheromones

Perception Channels: visual

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Behaviour

Adult beetles are attracted to volatile organic compounds produced by preferred host tree species. Both sexes are attracted to a volatile released by female A. glabripennis, and males attempt to copulate after contacting a sex pheromone on the female cuticle. (Hu et al. 2009)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Anoplophora glabripennis require between one and two years to completely develop from an egg to an adult. After mating in late summer, the females chew grooves in the bark of the host tree and lay a single egg in each groove. They then secrete a substance that hardens over and protects the egg. After about eleven days, the larvae hatch and begin to eat their way deeper into the tree. Larvae spend the winter feeding on the heartwood of the tree. Larvae then hollow out a chamber and pupate for 13-24 days, tunneling their way out of the tree as adults.

Development - Life Cycle: metamorphosis

  • Milius, S. June 12, 1999. Son of Long-Horned Beetles. Science News, Vol. 155, No. 24: 380.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

In the wild, Asian Long-Horned Beetles require between one to three years to reach maturity. The adult lifespan is about 50 days for males and 66 days for females. The lifespan of A. glabripennis in captivity is not known.

Average lifespan

Status: wild:
55-66 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Male beetles participate in mate guarding, often staying for hours after copulation to prevent the female from mating again with other males. Females may mate with a single male multiple times or with multiple males.

Mating System: polyandrous

Adult asian long-horned beetles are capable of mating as soon as they emerge from the host tree. Mating takes place on the branches and trunks of host trees between 12:00 PM and 6:00 PM. The female beetle lays an average of 32 eggs, one at a time, over an 11 day period. The eggs hatch in another 11 days. Over their lifetime, females produce between 30 and 80 eggs.

Range number of offspring: 30 to 80.

Key Reproductive Features: sexual ; fertilization (Internal ); oviparous

Parental Investment: no parental involvement

  • Milius, S. June 12, 1999. Son of Long-Horned Beetles. Science News, Vol. 155, No. 24: 380.
  • Cavey, J. February 8, 2000. "*Anoplophora glabripennis* (Motschulsky)" (On-line). Accessed March 19, 2002 at http://www.exoticforestpests.org/english/Detail.CFM?tblEntry__PestID=53.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anoplophora glabripennis

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 430 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBCL2714-06|NC_008221|Anoplophora glabripennis| AATAAGTGATTATTTTCTACCAATCATAAAGATATTGGAACACTTTACTTTATTTTTGGTGCATGAGCTGGAATACTTGGAACATCACTA---AGATTAATGATTCGATCAGAATTAGGTACTCCTGGTTCATTAATTGGAGAT---GATCAAATTTACAATGTGATTGTAACAGCCCATGCATTCATCATAATTTTTTTTATAGTTATACCTGTTATAATTGGTGGATTTGAAAATTGATTAGTTCCATTAATA---CTAGGTGCCCCAGATATAGCATTTCCACGAATAAATAATATAAGATTTTGATTACTCCCGCCTTCATTATTACTACTACTAATAAGAAGAATTGTAGATAGAGGAGCAGGAACAGGATGAACAGTTTATCCTCCATTAGCAGCTAATGTTGCACATAGAGGTTCTTCAGTTGATTTA---GCTATTTTCAGATTACATCTAGCTGGAATTTCTTCAATTTTAGGAGCAGTTAATTTTATTACAACTGTAATAAATATACGACCCCAAAAAATTAATATAGATCAATTACCTTTATTTGTATGAGCAGTAAAAATTACTGCTATTTTACTTTTACTATCCTTACCAGTTCTTGCTGGA---GCAATTACTATACTTTTAACAGATCGAAATTTAAATACTTCATTTTTTGATCCAGCAGGAGGAGGTGACCCCATTCTTTATCAACATTTATTTTGATTTTTTGGACATCCAGAAGTTTATATTCTTATTTTACCAGGATTTGGTATAATTTCTCATATTATTAGACAAGAAAGAGGAAAAAAA---GAAGCCTTTGGGACTTTAGGAATAATTTATGCAATAATAGCTATTGGACTTTTAGGATTTGTAGTTTGAGCTCATCATATATTTACAGTAGGTATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Anoplophora glabripennis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 414
Species: 422
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Conservation Status

There are currently no measures being taken to conserve this species.

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Management

Standard practice to control A. glabripennis in China is to spray insecticides in tree canopies. Wherever it is discovered outside its native range, infested trees are removed and destroyed. In North America, largely as a preventative measure, systemic insecticides are injected into trees.

Entomopathogenic fungi have been developed for the control of A. glabripennis, and entomopathogenic nematodes, coleopteran and hymenopteran parasitoids and predatory woodpeckers have been investigated as biocontrol agents. Ecological control of A. glabripennis in China involves planting mixtures of preferred and nonpreferred tree species, and this practice can successfully prevent outbreaks. (Hu et al. 2009)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

The economic effects of asian long-horned beetles in their native environment are not documented. In the United States, A. glabripennis have the potential to significantly impact industries such as maple syrup, timber, and nursery. Every tree that is found to have been infested by beetles must be destroyed in order to prevent the further spread of A. glabripennis. As of the summer of 2000, more than 4,000 trees were removed in New York, and another 1,400 were destroyed in the Chicago area. This resulted in total costs of more than $25 million dollars for both cities. It has been estimated that if the A. glabripennis infestation is not curbed in the United States, it could result in a total national cost of $669 billion. The beetle has already had an impact on the shipping industry. All cargo leaving China and Hong Kong in wooden pallets must undergo inspections before exiting the port, which increases the price of shipping. Wooden pallets were the method by which Asian Long-Horned Beetles entered the United States.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Econimic benefits derived from asian long-horned beetles have not yet been discovered.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

Risk Statement

Anoplophora glabripennis outbreaks began in China in the 1980s following major reforestation programs that used A. glabripennis-susceptible tree species (Haack et al. 2010). Nowak et al. (2001) investigated the potential maximum impact of A. glabripennis on urban trees in the United States. They predicted that this beetle could cause a loss of about a third of urban trees in the conterminous United States--more than a billion trees--with a compensatory value of nearly three quarters of a trillion dollars.

Based on their analyses of ecological parameters in the native range of A. glabripennis, Peterson et al. (2004) predict that the greatest risk of establishment in North America is in the eastern United States, where abundant appropriate habitat lies close to major shipping ports, especially in the region just south of the Great Lakes.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Asian long-horned beetle

The Asian long-horned beetle (Anoplophora glabripennis) known as the starry sky or sky beetle is native to eastern China, Japan, and Korea. This species has now been accidentally introduced to the United States, where it was first discovered in 1996, as well as Canada and several countries in Europe, including Austria, France, Germany, Italy and the UK. This beetle is believed to have been spread from Asia in solid wood packaging material.

Contents

Taxonomy

The genus Anoplophora comprises 36 species that occur throughout Asia, with the highest diversity in tropical and subtropical regions.[1] Anoplophora glabripennis belongs to the tribe Lamiini, subfamily Lamiinae, family Cerambycidae and order Coleoptera. The tribe Lamiini comprises eight additional genera: Goes, Hebestola, Lamia, Monochamus, Microgoes, Neoptychodes, Plagiohammus and Plectrodera. All species in these genera are xylophagous, attacking coniferous and deciduous trees.[2]

Physical description

Morphology

Adult Anoplophora glabripennis are very large insects with bodies ranging from 1 to 1.5 inches (2.5–4 cm) in length and antennae which can be as long as four inches (10 cm). They are shiny black with about 20 white spots on each wing cover and long antennae conspicuously banded black and white. These beetles can fly, but generally only for short distances, which is a common limitation for Cerambycidae of their size and weight. The upper sections of the legs of the adults are whitish-blue. Anoplophora glabripennis can be distinguished from related species by the markings on the wing covers and the pattern of the antennae.

Life cycle

Asian long-horned beetle larvae do not pupate before they reach a critical weight. Accordingly, they may overwinter either as larvae or as pupae, and depending on the weather they generally take about one to two years to complete their life cycles. In extreme cases they might take some three years. In their overwintering phase they are inactive, a dormant condition known as diapause. They resume their life cycle in the following summer.[3] Larvae first create a feeding gallery in the cambial region and later an apparently oval-shaped tunnel in the sapwood and heartwood. However, the oval cross-section might be largely illusory, caused by the angle of cutting through the tunnel; The emergence holes are normal to the wood surface, and look completely round. Larvae expel frass from their tunnels near the original oviposition site. Most individuals overwinter as larvae. Pupation occurs at the end of the larval tunnel usually in late spring and early summer.[3]

Adult longevity and fecundity are influenced by conditions such as the larval host plant and temperature. Anoplophora glabripennis adult females undergo a period of obligatory maturation feeding after emergence. On emergence, females can copulate, although their ovaries are immature and feeding is necessary for ovarian maturation.

Laboratory studies have estimated the female maturation period lasts 9–15 days.[4]

Adult males have mature spermatozoa before emergence, and feeding is necessary only to sustain their normal activity (Li & Liu, 1997). [2] Asian long-horned beetle larvae and adults chew and excavate wood with mandibles of modest size, but great strength. This too is characteristic of the family Cerambycidae. Adults, especially males, display long antennae used to sense the sex pheromones of potential mates. The conspicuous antennae probably act as aposematic signals to predators and in sexual rivalry as well. Accordingly the main targets for predation by birds for example, are the larvae.

Life expectancy

In the wild, Asian long-horned beetles require between one and three years to reach maturity. The adult lifespan is about 50 days for males and 66 days for females. The lifespan of Anoplophora glabripennis in captivity is not known.

Ecology

Habitat

In its native range, ALB infests trees primarily in the genera Acer (Sapindaceae), Populus (Salicaceae), Salix (Salicaceae), and Ulmus (Ulmaceae). In the United States, ALB has completed development on species of these genera and also Aesculus (Sapindaceae), Albizia (Fabaceae), Betula (Betulaceae), Cercidiphyllum (Cercidiphyllaceae), Fraxinus (Oleaceae), Platanus (Platanaceae), Prunus (Rosaceae), and Sorbus (Rosaceae). Acer is the most commonly infested tree genus in the United States, followed by Ulmus and Salix. In Canada, complete development has been confirmed only on Acer, Betula, Populus, and Salix, although oviposition has occurred on other tree genera. Acer is the most commonly infested tree genus in Canada. In Europe, complete development has been recorded on Acer, Aesculus, Alnus (Betulaceae), Betula, Carpinus (Betulaceae), Fagus (Fagaceae), Fraxinus, Platanus, Populus, Prunus, Salix, and Sorbus. The top five host genera infested in Europe, in decreasing order, are Acer, Betula, Salix, Aesculus, and Populus. Not all Populus species are equally susceptible to ALB attack. For example, in China, Populus species in sections Aigeiros and Tacamahaca are generally more susceptible to ALB than species in section Populus (=sect. Leuce).[3]

Dispersal

Although individuals do not typically disperse very far, some may travel as far as a kilometer or two in a season in search of new host trees.[2]

Feeding behavior

Adult Anoplophora glabripennis feed on leaves, twigs, and other plant matter. In their native habitat larvae of Anoplophora glabripennis feed on the healthy bark, phloem, and xylem of more than 24 species of hardwood trees.

Reproduction

Although the Asian long~horned beetle can fly for unbroken distances of 400 yards (370 m) or more in search of a host tree, they tend to lay eggs in the same tree from which they emerged as adults, migrating only when population density becomes too high. During the summer months, a mated adult ALB female chews some 35 to 90 individual depressions into the host tree's bark and lays an egg in each of the pits. The white, apodous eruciform larvae hatch out in 10–15 days.

The larvae are straight, with their front ends somewhat broader than the rest of the body. This is characteristic of many Cerambycid larvae, and so is the fact that instead of using legs to navigate their tunnels, they have fleshy pads on their segments. They press the pads against the tunnels walls for grip as they stretch or contract their bodies.[5]

As they eat, they tunnel into the tree's phloem and cambium layers beneath the tree bark. After several months, they tunnel deeper into the tree's heartwood where they mature into pupae. The total process from egg to pupation takes some 10–22 months, depending on the season, the weather, and the quality of the food supplied by the tree. Generally speaking, the phloem and cambium are the best food sources, but more exposed to predators such as woodpeckers, and a lot wetter. Heartwood and even sapwood are less nutritious, but more secure, so that is where the mature larva digs its pupation chamber.[6] They do not pupate before they have gained the necessary mass to support their adult activities and functions.

The pupal stage may last several months if pupation occurred at the start of the cold season, causing the pupa to go into diapause. The adults emerge from the pupae near the surface of the tree when the climate outside causes them to break diapause. They emerge as early as May and as late as October or November, depending on climate. The full-grown adult ALBs emerge through circular exit holes that typically measure 10–15 mm in diameter but can range from 6 to 20 mm.[2]

Damage

Asian long-horned beetle gallery development and exit holes weaken the integrity of infested trees and can eventually result in death of severely infested trees. Larvae are considered to be the most dangerous because they tunnel in the cambial region of wood. Larvae feeding reduces wood quality. After a tree has been occupied by generations of the beetles, larval feeding can disrupt the tree's vascular tissues, encourage fungal growth, and cause structural weakness, any of which might kill the tree. Adult Asian long-horned beetles are considered to be of minor importance since they feed on twigs, foliage and occasionally on fruit-bearing trees. Asian long-horned beetle attack both healthy and stressed trees, of any size from potted to mature trees.

The Asian long-horned beetle is now one of the most destructive non-native insects in the United States; it and other wood-boring pests cause an estimated $3.5 billion in annual damages in the United States.[7]

Detection of infestation

Mature beetles emerge from trees beginning in late May and lasting through October with a frequency peaking in July. Tree infestation can be detected by looking for exit holes 3/8 to 3/4 inches in diameter (1.5–2 cm) often in the larger branches of the crowns of infested trees. Sometimes sap can be seen oozing from the exit holes with coarse sawdust or "frass" in evidence on the ground or lower branches. Dead and dying tree limbs or branches and yellowing leaves when there has been no drought also signal ALB infestation. United States Department of Agriculture (USDA) research indicates this beetle can survive and reproduce in most sections of the country where suitable host trees exist.

Infestations in North America

Adult ALBs can be seen from late spring to fall, depending on the climate. The ALB was first discovered in the United States in 1996 in the Greenpoint section of Brooklyn. Shortly after, another infestation was detected in Amityville on Long Island. Since then infestations have been found in the Islip area of Long Island in Queens and in Manhattan. In fact, several infested trees were removed around Central Park. The ALB was discovered in Chicago in 1998. An ALB infestation was detected in Hudson County, New Jersey in 2002 and in the Central New Jersey Middlesex and Union Counties in 2004. In 2008 a sizeable infestation resulting in the removal of more than 28,000 trees was discovered in Worcester, Massachusetts.[8] Ongoing inspection of host trees within the 98 sq mi (250 km2) quarantine area of Worcester county[9] has revealed that, since 2008, over 19,000 trees were infested;[10] there is some evidence that the infestation may date back as far as 1997.[11] On July 5, 2010, six infested trees were found on the grounds of the Faulkner Hospital in the Jamaica Plain neighborhood of Boston, Massachusetts,[12] which is across the street from the Arnold Arboretum, where an infestation is poised to devastate the oldest arboretum in America. As of 2011, the ALB is considered a threat to the forestry industry in Ohio and steps are being taken to eradicate it.

Alert workers have uncovered and reported ALBs in warehouses in CA, FL, IL, IN, MA, MI, NC, NJ, NY, OH, PA, SC, TX, WA, WI, and in British Columbia, Manitoba, Ontario, Quebec and Nova Scotia in Canada.

The beetle has also invaded Britain, Austria and Germany.

Background

The ALB was believed to have arrived in New York City in the 1980s in wood packing material. According to Victor Mastro, the Director of Animal and Plant Health Inspection Service Laboratory on Cape Cod, Massachusetts, the center of the infection zone was a warehouse which imported plumbing supplies from China (Smith, 2003). The infestations in Hudson County, New Jersey and on Long Island are believed to have spread from the Brooklyn point of entry. The infestations in Chicago and central New Jersey are believed to have come from a separate point of entry.

The Greenpoint infestation was first reported by Ingram Carner of Greenpoint on a Saturday in August 1996 and identified by Cornell University entomologist Richard Hoebeke on August 19. The Amityville infestation was brought, inadvertently, from Brooklyn by the Mike Ryan Tree Services, a tree pruning company, which performs work for the NYNEX telephone company.[13]

Timeline of discoveries

The Canadian Food Inspection Agency is spearheading efforts to fight the ALB infestation in the Greater Toronto Area.

Eradication efforts

Over 1,550 trees in Chicago have been cut down and destroyed to eradicate ALB from Chicago. In New York, over 6000 infested trees resulted in the removal of over 18,000 trees; New Jersey's infestation of over 700 trees lead to the removal and destruction of almost 23,000 trees,[22] Infested trees continue to be discovered.[23] 28,000 trees have been removed in Worcester, MA because of the nearly 20,000 trees confirmed to be infested with the Asian longhorned beetle. The December 12, 2008 ice storm likely resulted in significant moving of infested downed limbs because of frantic homeowners clearing debris within the infestation following the devastating ice storm. This has complicated the eradication effort. A Worcester exterminator has had a beetle in his collection since 1997, and USDA APHIS PPQ has confirmed his finding, meaning the beetle has been in Worcester for at least 13 years, giving it a very long time to move about, especially since vehicles were often parked under infested trees, giving the beetles an opportunity to drop onto cars and be transported elsewhere.

The US Federal government is trying to eradicate this species primarily for two reasons:

  • If it becomes established it could significantly impact natural forests and urban environment, with an estimated death toll of 1.2 billion trees if it spread nationwide.[24]
  • Due to the current limited infestation size, it is believed that eradication efforts can be successful.

The steps that have been taken to eliminate the ALB include:

  • Quarantines. Quarantines have been established around infested areas to prevent accidental spread of ALB by people.
  • Infested trees cut, chipped and burned. All infested trees are being removed, chipped in place, and the chips are being burned. The stumps of infested trees are ground to below the soil level. All tree removal is done by certified tree care personnel to ensure that the process is completed properly.
  • Insecticide treatments. Research is underway to determine the effectiveness of certain insecticides such as imidacloprid against ALB. Insecticidal treatments have begun in New York and Chicago in hopes of preventing and containing infestations. Chicago's program of imidacloprid treatments for healthy trees of potential host species within a one-eighth to one-half mile (200–800 m) radius of infested trees successfully removed Illinois from quarantine in August 2006. As of December 2006, New Jersey's policy was to cut down all healthy trees of the potential host species within a one-eighth to one-quarter mile (200–400 m) radius of infested trees.
  • Extensive surveys. All host trees on public and private property located within an established distance from an infested area are surveyed by trained personnel. Infested areas are re-surveyed at least once per year for 3–5 years after the last beetle or infested tree is found.
  • Shipping restrictions. The use of Solid Wood Packing Materials (SWPM) for maritime shipping is regulated for adequate treatment methods at certain ports.[25][26]

US customs regulations were changed on September 18, 1998 (effective December 17, 1998) to require wooden packing materials from China be chemically treated or kiln-dried to prevent further infestations of the Asian long-horned beetle from arriving. Pest inspection, new rules, and public awareness are the key steps to prevention of the spread of the Asian long-horned beetle.

Trees that are being planted to replace host trees include: Serviceberry or Shadbush, Ironwood, Southern catalpa, Turkish filbert, Ginkgo, Honey locust, Kentucky coffeetree, Tuliptree, Dawn redwood, White oak, Swamp white oak, Bur oak, English oak, Japanese lilac, Bald cypress, Basswood, and Little-leaf Linden.

Possible outcome from infestation

Asian long-horned beetles are detrimental to any ecosystem they inhabit. In China, approximately 40% of poplar plantations have been damaged, meaning the wood is good only for packing material. In the Ningxia Province of China, more than 50 million trees were destroyed over a three-year period because of the beetles. These beetles have the ability to significantly alter the composition of North American hardwood forests. It is estimated that nearly one-third of all trees would have to be destroyed in the United States if Anoplophora glabripennis were to spread throughout the country. The potential for widespread distribution in North America and the attack of a wide range of host trees is also very possible.

See also

Notes

  1. ^ Hoebeke, E. Richard; Lingafelter, Steven M. (2002). Revision of the genus Anoplophora (Coleoptera: Cerambycidae). Washington, D.C: Entomological Society of Washington. ISBN 0-9720714-1-5. 
  2. ^ a b c d Jiafu Hu, Sergio Angeli, Stefan Schuetz, Youqing Luo & Ann E. Hajek (2009). "Ecology and management of exotic and endemic Asian longhorned beetle Anoplophora glabripennis". Agricultural and Forest Entomology 11 (4): 359–375. doi:10.1111/j.1461-9563.2009.00443.x. 
  3. ^ a b c Robert A. Haack, Franck Hérard, Jianghua Sun & Jean J. Turgeon (2009). "Managing invasive populations of Asian long-horned beetle and citrus long-horned beetle: a worldwide perspective". Annual Review of Entomology 55: 521–546. doi:10.1146/annurev-ento-112408-085427. PMID 19743916. 
  4. ^ M. A. Keena (2002). "Anoplophora glabripennis (Coleoptera: Cerambycidae) fecundity and longevity under laboratory conditions: comparison of populations from New York and Illinois on Acer saccharum" (PDF). Environmental Entomology 31 (3): 490–498. doi:10.1603/0046-225X-31.3.490. http://ddr.nal.usda.gov/bitstream/10113/11796/1/IND23334661.pdf. 
  5. ^ Imms' General Textbook of Entomology: Volume 1: Structure, Physiology and Development Volume 2: Classification and Biology. Berlin: Springer. 1977. ISBN 0-412-61390-5. 
  6. ^ Bannister, Anthony; Skaife, Sally; Ledger, John (1979). African insect life. Feltham: Country Life Books. ISBN 0-600-34920-9. 
  7. ^ ""Economic Impacts of Non-Native Forest Insects in the Continental United States" at Journalist's Resource.org". http://journalistsresource.org/studies/environment/sustainability/invasive-forest-insects/. 
  8. ^ "Beetle problem a familiar story". Worcester Telegram & Gazette. 2008-08-24. http://www.telegram.com/article/20080824/NEWS/808240422. Retrieved 2011-06-22. 
  9. ^ http://www.worcesterma.gov/e-services/document-center/city-manager/alb-regulated-area.pdf
  10. ^ "Beetles found in more trees". Worcester Telegram & Gazette. 2008-10-29. http://www.telegram.com/article/20081029/NEWS/810290622. Retrieved 2011-06-22. 
  11. ^ "Beetle may be pinned to '97". Worcester Telegram & Gazette. 2008-08-30. http://www.telegram.com/article/20080830/NEWS/808300336/-1/BEETLES. Retrieved 2011-06-22. 
  12. ^ "Boston readies to battle beetles". The Boston Globe. July 6, 2010. http://www.boston.com/news/local/massachusetts/gallery/Boston_readies_to_battle_beetles/. 
  13. ^ APHIS Web - PPQ - Asian Longhorned Beetle - New Pest Advisory Group Report[dead link]
  14. ^ http://www.nycgovparks.org/sub_your_park/trees_greenstreets/beetle_alert/images/infestation_050427_CPelm_new.pdf
  15. ^ "Press Release". Nj.gov. 2002-10-11. http://nj.gov/agriculture/news/p21011a.htm. Retrieved 2011-06-22. 
  16. ^ September 18, 2003 Asian Longhorned Beetle discovered in York Region
  17. ^ "August 7, 2008 Pest alert: Asian long-horned beetle detected in Massachusetts". Massnrc.org. 2008-08-07. http://www.massnrc.org/pests/linkeddocuments/pestalerts/ALB_Aug2008.htm. Retrieved 2011-06-22. 
  18. ^ "August 7, 2008 Tree-devouring Asian beetle found in Worcester". Boston.com. 2008-08-07. http://www.boston.com/lifestyle/green/greenblog/2008/08/treedevouring_asian_beetle_fou.html. Retrieved 2011-06-22. 
  19. ^ "Browning in Greendale". Telegram.com. August 8, 2008. http://www.telegram.com/article/20080808/NEWS/808080332/1020. Retrieved 2011-06-22. 
  20. ^ "Massachusetts Introduced Pests Outreach Project". Massnrc.org. http://www.massnrc.org/pests/alb/index.htm. Retrieved 2011-06-22. 
  21. ^ Jason Markovich (July 6, 2010). "Asian longhorned beetles found in Boston". National Association of State Departments of Agriculture. http://www.nasda.org/cms/7197/9060/27611/27630.aspx. Retrieved October 25, 2011. 
  22. ^ Newspaper Archive (dead link as of at least March 16, 2009)
  23. ^ "June 11, 2010 Detailed Map Showing New York City's Asian long-horned beetle infestation from 2007 to 2010". Pallettruth.com. http://www.pallettruth.com/beetle-nyc-wood-infestation/. Retrieved 2011-06-22. 
  24. ^ Mance III, Dave (Winter 2008). "Knots & Bolts: Notes from the Quarantine Zone". Northern Woodlands (Center for Northern Woodlands Education) 15 (4): 18. http://northernwoodlands.org/knots_and_bolts/notes_from_the_quarantine_zone/. Retrieved 29 July 2009. 
  25. ^ "A Summary of U.S. Entry Requirements According to 7CFR 319.40". Aphis.usda.gov. 1998-12-17. http://www.aphis.usda.gov/newsroom/hot_issues/alb/swpm/swpmsum.html. Retrieved 2011-06-22. 
  26. ^ "Requirements for Wood Packing Material Products (SWPM)". Kline.com. http://www.kline.com/KAMCompliance/Import_Wood_Packing_Materials_Reguirements.asp. Retrieved 2011-06-22. 

References

  • "Wanted: The Asian Longhorned Beetle" USDA APHIS Publication, May 2008, Suzanne Bond
  • Antipin, Judy and Dilley, Thomas. "Chicago vs. Asian Longhorn Beetle: A Portrait of Success"
  • http://purl.access.gpo.gov/GPO/LPS6632
  • Smith, Jennifer. "Monsters in Miniature: An Exotic Invader Threatens U.S. Hardwoods". April 13, 2003 Newsday.com.
  • Woodsen, Mary. "Cities Under Siege". American Forests Summer 2000: 7.
  • Cavey et al. 1998; Nowak et al. 2001 and references therein; Smith et al. 2001; Hu et al. 2009
  • Cavey and February 8, 2000; Smith et al., December 2001
  • Cavey and February 8, 2000; Nowak et al., 2001; Smith, June 1999
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!