Articles on this page are available in 1 other language: Spanish (2) (learn more)

Overview

Brief Summary

Description

Collared Pikas are common in the mountains of central and southern Alaska, particularly above timberline. They are very vocal animals, calling loudly to one another with short, sharp sounds that may be alarm calls or have a role in courtship. Their hearing and vision are excellent, and they climb with agility. They require a rocky area for cover, and a nearby meadow or other patch of vegetation where they can forage. Although winter conditions are harsh, Collared Pikas do not hibernate. In the summer they accumulate piles of cut grass and other vegetation to get them through winter, and yet they must still do some winter foraging: their haypiles are insufficient to meet all their nutritional needs. Related to rabbits and hares, pikas resemble those lagomorphs, but they have much shorter legs and short, rounded ears.

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: Nelson, E.W., 1893.  Description of a new species of Lagomys from Alaska, p. 117.  Proceedings of the Biological Society of Washington, 8:117-120.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Ochotona collaris has a wide geographic distribution that includes central and southern Alaska, almost the entirety of the Yukon Territory, northwestern British Columbia, and the western regions of the Northwest Territory (MacDonald and Jones 1987, Smith et al. 1990). This species has been recorded occurring above the treeline in Alaska and the Yukon Territory, as well as elevations near sea level (MacDonald and Jones 1987).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Collared pikas, Ochotona collaris, are found in the mountainous regions of central and southeastern Alaska, in the Yukon-Tanana uplands to the Chigmit Mountains, and from the Richardson Mountains north of the Artic circle in the Yukon, west of the Mackenzie River in the Northwest Territories, and south into northwestern British Columbia (MacDonald and Jones, 1987).

Biogeographic Regions: nearctic (Native )

  • Franken, R., D. Hik. 2004. Influences of habitat quality, patch size, and connectivity on colonization and extinction dynamics of collared pikas Ochotona collaris. Journal of Animal Ecology, 73: 889-896.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Mountains of central and southern Alaska from Yukon-Tanana uplands and Chigmit Mountains to head of Lynn Canal near Skagway; in Canada from Richardson Mountains, Yukon and Mackenzie, south to northwestern British Columbia and west to near Mackenzie River, Northwest Territories. Sight records for Brooks Range, Alaska.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Collared pikas share common characteristics with other Ochotona species, such as their small size (around 160 g), short round ears, and a concealed tail (Smith, 2008). Their hind limbs are slightly larger than the front limbs with 5 digits on each forefoot and 4 digits on each hind foot. They have hairy plantar surfaces on the feet. Their skulls are relatively flat, with narrow zygomatic arches, short narrow rostra, and a fenestrated maxilla. Distinctive skull characteristics of ochotonids are an absent supraobital process and spongy auditory bullae. The dental formula is; I 2/1 with 2nd peg like incisors, C 0/0, P 2/3, M 2/3 (MacDonald and Jones, 1987).

Collared pika ventral fur is creamy white and the dorsal fur is grayish. There are distinctive patches on the nape and shoulder forming a collar thus giving them their common name. The most diagnostic characteristic of the collared pikas is the creamy-buff fur patch over the facial gland which differs from their close relative, American pikas (Ochotona princeps), which has a brown patch. They have a common ano-genital opening, similar to birds, that is considered a pseudo-cloaca (MacDonald and Jones, 1987; Broadbooks, 1965). There is no sexual dimorphism (Smith, 2008). Sexing is done by investigating their pseudo-cloaca opening for evidence of genetalia.

Range mass: 130 to 200 g.

Average mass: 160 g.

Range length: 17.8 to 19.8 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

  • Smith, A. 2008. Lagomorph Biology: Evolution, Ecology, and Conservation. Berlin Heidelberg: Springer-Verlag. Accessed November 15, 2008 at http://www.springerlink.com/content/n5m1687741615687/.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 20 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: None

Length:
Average: 189 mm
Range: 178-198 mm

Weight:
Average: 129 g
Range: 117-145 g
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Ochotona collaris
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Unknown; Adult
Preparation: Skin; Skull
Collector(s): E. Nelson
Year Collected: 1880
Locality: Fort Yukon, About 200 Mi S; Near Head Tanana River, Alaska, United States, North America
  • Type: Nelson, E. W. 1893 Dec 21. Proc. Biol. Soc. Wash. 8: 117.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Ochotona collaris is a typical rock-dwelling species of pika (Smith et al. 1990). Talus sites are often located in proximity to vegetation patches and meadows (MacDonald and Jones 1987). Home ranges for this species are typically 30 m in diameter (MacDonald and Jones 1987). O. collaris is a general herbivore that constructs haypiles (Smith et al. 1990; Franken and Hik 2004). However, individuals that occupy nunataks (rocky outcroppings) of the Yukon Territory in Canada will collect and forage upon the brain matter of dead birds to supplement their diet (Krajick 1998). A recent study found that increased risk of predation did not alter vegetative selection, but did decrease the overall amount collected (Morrison 2007). O. collaris is a diurnal pika, active in the morning and late afternoon (MacDonald and Jones 1987). The breeding season peaks from May to early June (MacDonald and Jones 1987). The season is timed to allow parturition to coincide with the start of vegetative growth. Litter size for this species is two to six, with two litters produced per year (MacDonald and Jones 1987). A recent study suggests that a reduced breeding season, resulting from high latitudinal orientation, may limit this species to a single litter per year (Franken and Hik 2004). Young are weaned within three to four weeks and reach reproductive maturity by one year of age (Franken and Hik 2004). Gestation time is approximately 30 days (MacDonald and Jones 1987). Adult size is reached between 40-50 days (MacDonald and Jones 1987). The total length of this species is 18.9 cm (Hall 1981).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Collared pikas most commonly live in mountainous terrain that contains rock slides with large boulders and talus slopes. They favor the borders of talus slopes that are closest to meadows and patches of high quality vegetation. Collared pikas often colonize taluses that are on southwest facing slopes because they tend to have shorter period of snow cover and a longer plant growing season (Franken and Hik, 2004a). They also have been recorded inhabiting areas near sea level in southern Alaska and British Columbia (MacDonald and Jones, 1987; Broadbooks, 1965). Their habitat is characterized as dominantly subalpine and alpine with strong seasonal variations and a short growing season for vegetation (June to August).

Range elevation: 0 to 3,688 m.

Habitat Regions: polar ; terrestrial

Terrestrial Biomes: tundra ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Mostly in rock slides, talus slopes, and among large boulders, usually near meadows and patches of veg. Usually above timberline but occasionally in forested valleys and near sea level (MacDonald and Jones 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Like other pikas, collared pikas are an excellent example of an ecotone species, meaning their home and shelter are separated from their food storage (Broadbooks, 1965). Pikas are herbivorous and spend the summer months actively collecting a wide range of vegetation to subsist on during the winter months. Ochotona species, like other lagomorphs produce two kinds of fecal pellets: hard and soft. They consume their soft pellets to reduce the loss of nutritional value in their food. They also consume fecal pellets of other species such as hoary marmots (Marmota caligata) and ermine (Mustela erminea) (Broadbooks, 1965). Although they are primarily herbivorous, collared pikas have been recorded to consume birds as an opportunistic source of protein and fat (Krajick, 1998). If insufficient hay reserves are stockpiled in the summer, collared pikas may have to resort to eating lichens and other small plants in underground snow tunnels during winter.

Animal Foods: birds

Plant Foods: leaves; flowers

Other Foods: dung

Foraging Behavior: stores or caches food

Primary Diet: herbivore (Folivore )

  • Krajick, K. 1998. Nunataks. National Geographic, December: 62-71.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Feeds primarily on grasses and sedges; also eats some forbs (especially DRYAS) as well as the shoots of woody vegetation and dry fecal pellets of Hoary Marmots (Marmota caligata). In summer and fall harvests and stores food for winter consumption.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Ochotona collaris is a key species that is consumed by numerous predators. Their hay piles could provide food for other herbivorous mammals. Collared pikas, along with other herbivorous mammals like hoary marmots (Marmota caligata) impact grass and herbaceous plant species in their high elevation habitats (Koh and Hik, 2007).

  • Koh, S., D. Hik. 2007. Herbivory meditates grass-endophyte relationships. Ecology, 88(11): 2752-2757.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Collared pikas have no natural defense against predators besides hiding in cracks, crevices, and under large boulders in talus. They forage close to their home burrows. There are several known carnivorous predators, including ermine, foxes, weasels, lynx, and coyotes. Also, numerous birds of prey such as eagles and owls will hunt collared pikas (Broadbooks, 1965; Holmes, 1991; Morrison et al., 2004).

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

May defend home territory about 30 m in diameter (700 sq m). Population density estimated at 6.4-7.2/ha. Ermine (Mustela erminea) apparently is the most important predator (MacDonald and Jones 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Collared pikas are very vocal, with both sexes emitting calls. The call of a pika is unmistakable once it has been heard. The call is a single, piercing note that sounds like “ank” or “ink” and can be heard for several hundred yards. When calling, pikas sit with their body hunched and noses pointed slightly in the air. Collared pikas vocalize frequently during hay gathering. After depositing food they will make one or two territorial calls from hay piles to neighboring pikas. Other forms of communication include chattering, a continuous clicking of teeth by males during reproductive season, and estrous calls by females (MacDonald and Jones, 1987). Another function of vocalization serves as a predator warning to neighboring pikas, territory defense, and also establishing and maintaining social structure. Unlike American pikas (Ochotona princeps), which can produce 9 different vocalizations, collared pikas do not have an extensive repertoire. Both territorial and predator calls produced sound approximately the same (Trefry, Ochotona thesis 2008).

Communication Channels: acoustic

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Active throughout the year. Most active in morning and late afternoon (MacDonald and Jones 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Collared pikas can have a relatively long lifespan, up to 6 to 7 years (Smith, 2008). Collared pika over-winter mortality is high and populations are continuing to decrease over time (Morrison and Hik 2007; Franken and Hik, 2004b; Smith et al., 2004). Adult and juvenile survival is strongly linked to environmental conditions such as climate (Franken and Hik, 2004b). Adult survival is correlated with the Pacific Decadal Oscillation (PDO), with a time lag of 1 year. The timing and amount of snowfall and snowmelt are influenced by the PDO. This, in turn, alters growing season and food availability for collared pikas. Snow-pack is important in insulating pikas from temperature extremes during winter months. A low snow-pack year could expose collared pikas and their stored food to freezing ambient temperatures, but an earlier snowmelt could lengthen the growing season and allow more time to feed and store food for the next winter (Smith et al. 2004; Morrison and Hik, 2007).

Range lifespan

Status: wild:
7 (high) years.

Average lifespan

Status: wild:
6.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: Little is known about the longevity of these animals. In the wild, they have been estimated to live up to 6 years (Bernhard Grzimek 1990).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Collared pikas exhibit an alternating male-female distribution pattern of home ranges and tend to simply mate with their nearest neighbor (Franken and Hik, 2004b; Smith, 2008). Collared pikas are considered facultatively monogamous because most males are unable to control enough territory to gain access to multiple females.

Mating System: monogamous

The peak of the breeding season occurs in May and early June. Females have up to two litters a year that range between 2 to 6 young each and average 2.2 individuals weaned. Parturition tends to be synchronous. Parturition dates vary among years in response to the highly seasonal habitat. This strategy allows full advantage of the best conditions for growth of young. Gestation last between 3 to 4 weeks (30 days). Collared pikas reach adult size in 40 to 50 days. Both females and males can breed and produce young at one year of age. However, male reproductive success depends on gaining habitat and attracting females (Franken and Hik, 2004b). Juveniles will disperse within the natal talus patch immediately following the end of gestation to make their own territory (Franken and Hik, 2004a). Although, some species of pikas have be known to have post-partum estrous and produce a second litter per year further research is need to investigate if this is true for O. collaris.

Breeding interval: Collared pikas breed once yearly.

Breeding season: Breeding occurs from May to June.

Range number of offspring: 2 to 6.

Average number of offspring: 2.2.

Range gestation period: 3 to 4 weeks.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 9 g.

Average number of offspring: 5.

Average age at sexual or reproductive maturity (female)

Sex: female:
365 days.

Young collared pikas are born blind and nearly hairless. Female collared pikas are responsible for most of the parental investment and bear the brunt of energetic constraints of gestation and lactation. This could lead to a gradual decrease in litter size over the reproductive season due to pre-implantation losses, resorption of embryos, or losses during weaning which results in 2 to 3 young surviving to be weaned. Because it is not easy to distinguish between sexes by sight it is difficult to observe male investment in rearing offspring.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

  • Franken, R., D. Hik. 2004. Influences of habitat quality, patch size, and connectivity on colonization and extinction dynamics of collared pikas Ochotona collaris. Journal of Animal Ecology, 73: 889-896.
  • Smith, A. 2008. Lagomorph Biology: Evolution, Ecology, and Conservation. Berlin Heidelberg: Springer-Verlag. Accessed November 15, 2008 at http://www.springerlink.com/content/n5m1687741615687/.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeding apparently peaks May-early June. Gestation lasts about 30 days. Produces 1 or 2 litters of 2-6 young, May-September. Young reach adult size in 40-50 days. Females can breed and produce young at about 1 year of age (MacDonald and Jones 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ochotona collaris

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBMA0562-06|NC_003033|Ochotona collaris| AACCGTTGACTATTCTCCACAAATCACAAAGACATTGGCACCCTGTACATATTATTCGGTGCTTGAGCTGGGATAGTGGGTACTGCACTC---AGCCTCCTCATCCGAGCCGAGCTCGGACAACCCGGAGCTCTGTTGGGAGAT---GACCAGATCTACAACGTAATCGTCACAGCCCACGCTTTTGTTATAATTTTCTTTATGGTGATGCCAATTATAATCGGAGGGTTCGGTAACTGGTTAGTACCATTAATG---ATTGGTGCGCCCGATATAGCCTTCCCCCGAATAAACAACATAAGTTTCTGACTTCTACCGCCCTCATTCCTACTTCTACTGGCATCCTCAATAGTCGAAGCAGGTGTAGGAACCGGCTGAACTGTATACCCCCCTTTAGCCGGCAACTTAGCCCACGCAGGAGCATCCGTAGATCTA---GCAATTTTCTCCCTTCACCTAGCCGGAGTTTCCTCAATTCTTGGGGCTATCAACTTCATTACAACAATCATTAACATAAAACCCCCTGCCATGTCCCAATACCAAACCCCCCTATTTGTTTGATCCGTCCTCATTACAGCTGTCCTTCTACTTCTCTCCCTACCAGTCCTAGCAGCA---GGGATTACTATGCTTCTAACAGACCGAAATCTAAACACAACTTTTTTCGACCCAGCAGGAGGCGGAGATCCCATCTTGTACCAACACTTATTCTGGTTCTTCGGCCACCCTGAAGTTTACATTTTAATTCTACCAGGGTTCGGTGTAATCTCTCACATTGTCACCTACTACTCTGGCAAAAAA---GAACCCTTCGGCTACATAGGAATAGTCTGGGCCATGATATCCATTGGCTTCCTAGGGTTTATTGTCTGAGCCCACCATATATTTACAGTAGGCATAG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ochotona collaris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 1
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Smith, A.T. & Johnston, C.H.

Reviewer/s
Boyer, A.F. & Johnston, C.H. (Lagomorph Red List Authority)

Justification
This is a widespread species that is unlikely to be experiencing a decline significant enough to warrant listing under a threat category. Ochotona collaris occurs in remote regions of Alaska (USA) and northwestern Canada, where it is unlikely to be negatively influenced by human activities (Smith et al. 1990).

History
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

The IUCN lists collared pikas as lower risk/least concern. While this suggests there is no concern for populations at this time, they could respond negatively to climate change. Collared pikas are sensitive to high ambient temperatures and are restricted to high elevation habitats that are declining in response to climate change (Smith et al., 2004).

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

  • 2008. "IUCN Red List of Threatened Species" (On-line). Accessed November 17, 2008 at http:// www.iucnredlist.ord.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There are no current data regarding the population status of Ochotona collaris. Population densities have been estimated at 6.4-7.2 individuals/ha (Broadbooks 1965). In other regions of the Yukon population density ranges from below 1.0 up to 4.0 pikas/ha (Morrison 2007). A study conducted in the Ruby Range (Yukon, Canada) indicated that population abundance at the study site has experienced a decline since 1995 (Morrison 2007). A population viability analysis on census data collected from 1995 to 2006 produced a greater than 90% probability of extinction within 10-15 years, for the study site at Ruby Range (Morrison 2007).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
There are no known threats for Ochotona collaris, although it may be vulnerable to global climate change. It is unlikely that this species will be negatively influenced by human activities, as it occurs in remote regions of Alaska (USA) and northwestern Canada (Smith et al. 1990). Recent changes to Alaskan hunting regulations permit the unlimited trapping of pika for food and pelt (Mowry 2006) during a year round open season along the eastern regions of the state (Alaska Department of Fish and Game 2006). This policy may lead to local depression of populations as a result of intrinsic low density and reproductive rate.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no known conservation measures in place for this species. Recent changes to the hunting regulations in Alaska allow for the unlimited, year-round hunting and trapping of Ochotona collaris (Alaska Department of Fish and Game 2006). Monitoring for negative consequences should be implemented, as this species occurs naturally at low densities and has one of the lowest reproductive rates for small mammals.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known negative effects of collared pikas on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Collared pikas are interesting and unique members of their alpine habitats. Pika haypiles and fecal pellets may improve the chances of plant colonization on talus slopes and fertilize soils. Cached winter hay piles produced by other species of pikas are collected and harvested by farmers to feed domestic cattle and sheep in Siberia (Danell et al., 1998).

  • Danell, K., T. Willebrand, L. Baskin. 1998. Mammalian herbivores in the boreal forests: their numerical fluctuations and use by man.. Conservation Ecology, 2(2): 9. Accessed November 15, 2008 at http://www.consecol,org/vol2/iss2/art9.
  • Smith, A., N. Formozov, R. Hoffmann, Z. Changlin, M. Erbajeva. 1990. The Pikas. Pp. 14-26 in J Chapman, J Flux, eds. Rabbits, Hares and Pikas. Gland, Switzerland: International Union for Conservation of Nature and Natural Resources.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Collared Pika

The Collared Pika (Ochotona collaris) is small (~160 gram) alpine lagomorph that lives in boulderfields of central and southern Alaska (U.S.),[3] and in parts of Canada, including northern British Columbia, Yukon, and western parts of the Northwest Territories. It is closely related to the American Pika (O. princeps). It is asocial, does not hibernate,[4] and spends a large part of its time in the summer collecting vegetation that is stored under rocks ("haypiles") as a supply of food for the winter.[5] Thousands of trips are made during July and August to collect vegetation for winter.

The Collared Pika is reproductively mature at one year and gives birth to 2-3 young each year in nests within the talus. The young remain in the nest for approximately 30 days before they are weaned and emerge to the surface. Juveniles remain on the natal territory for only a short time (a few days) before they become independent and disperse to find their own territories.

References

  1. ^ Hoffman, Robert S.; Smith, Andrew T. (16 November 2005). "Order Lagomorpha (pp. 185-211". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). pp. 186-187. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3. 
  2. ^ Smith, A.T. & Johnston, C.H. (2008). Ochotona collaris. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 10 November 2008. Database entry includes a brief justification of why this species is of least concern.
  3. ^ Savage, Melissa. "Ochotona collaris". Animal Diversity Web. http://animaldiversity.ummz.umich.edu/site/accounts/information/Ochotona_collaris.html. Retrieved 2007-08-22. 
  4. ^ "Ochotona collaris". Smithsonian National Museum of Natural History. http://www.mnh.si.edu/mna/image_info.cfm?species_id=226. Retrieved 2007-08-22. 
  5. ^ "Collared Pika". Yukon Government. http://www.environmentyukon.gov.yk.ca/wildlifebiodiversity/mammals/pika.php. Retrieved 2007-08-22. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Has been regarded as conspecific with O. princeps or O. alpina by some authors; regarded as a distinct species by Hall (1981), Jones et al. (1992), and Hoffmann and Smith (in Wilson and Reeder 2005).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!