Articles on this page are available in 1 other language: Chinese (Simplified) (6) (learn more)

Overview

Distribution

Range Description

Octotona alpina occurs in the northern mountain ranges around the Gobi desert and in the regions east and south of Lake Baikal (Smith et al. 1990). This species also occurs in northwestern and northeastern China (Smith and Xie 2008). O. alpina occurs at elevation of 400-2,500 m in the Altai Mountains (Ognev 1966), in China, O. alpina occurs at elevations greater than 2,000 m (Smith and Xie 2008).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Ochotona alpina occupies rocky regions and talus piles (Smith et al. 1990). Because this is a rock-dwelling species it occupies naturally fragmented habitat, as talus piles are generally separated by terrain that pikas rarely traverse. It prefers talus sites where vegetation is present (Smith et al. 1990). This species is a generalized herbivore that collects foodstuffs to create haypiles (Smith and Xie 2008). This pika is considered an important factor in the health of the ecosystem, as it is prey for sables in the region (Khlebnikova 1978). It has been noted that pika haypiles have been utilized by several species during winter months (Smith et al. 1990). Siberian wapiti (Cervus elaphus sibiricus) and reindeer (Rangifer tarandus) will eat from the haypiles during heavy snowfall (Smith et al. 1990). It has been reported that vegetation diversity and composition are largely influenced by the presence of this species (Khlebnikova 1978). It is primarily a diurnal species, but vocalizations can be heard at night (Ognev 1966). Reported mortality rates differ according to habitat type; 41% in alpine zones and 53% in forested areas (Smith et al. 1990). Longevity of O. alpina can be as high as six years, but is usually only three years in the northern extents of its range (Sokolov et al. 1994). O. alpina produces two litters per year, with an average of three young per litter (Smith and Xie 2008). Gestation is approximately 30 days and newborns are 5.8-6.0 cm in length (Sokolov et al. 1994). Total length is 15.2-23.5 cm (Smith and Xie 2008).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ochotona alpina

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 13 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTATACTTACTATTTGGCGCTTGAGCTGGCATAGTAGGCACTGCACTCAGTCTTCTCATCCGAGCCGAACTTGGTCAACCTGGGGCCCTCCTAGGAGACGACCAGATTTACAATGTAATCGTCACAGCCCACGCTTTCGTTATAATTTTCTTCATAGTAATACCCATCATGATTGGCGGGTTCGGTAATTGACTAGTGCCTTTAATAATTGGTGCACCTGACATAGCTTTCCCCCGAATAAACAACATAAGCTTCTGACTTCTACCCCCCTCATTCCTACTTCTGTTAGCATCATCAATAGTCGAAGCGGGAGTAGGAACCGGCTGAACAGTTTACCCCCCTCTAGCCGGCAACCTAGCCCACGCAGGAGCATCTGTAGATTTAGCAATTTTCTCGCTTCACTTGGCTGGCGTCTCTTCAATTCTTGGCGCTATTAATTTCATTACAACAATTATTAACATAAAACCCCCAGCCATGTCCCAATACCAAACCCCTCTATTTGTTTGATCTGTCCTTATTACAGCTGTCCTACTGCTACTTTCACTACCCGTCCTAGCAGCAGGCATCACTATACTTCTAACTGATCGAAACCTAAACACAACCTTTTTCGACCCTGCAGGAGGCGGAGACCCTATTCTGTATCAGCACTTGTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ochotona alpina

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 19
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Smith, A.T. & Johnston, C.H.

Reviewer/s
Boyer, A.F. & Johnston, C.H. (Lagomorph Red List Authority)

Justification
This is a widespread species with no currently known population decline.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There are few data regarding the current status of Ochotona alpina. A density decline occurred in the 1970's throughout the western region of the Sayan mountain range (Smith et al. 1990). This reduction was characterized as "catastrophic" and the causes are unclear (Smith et al. 1990). As of the late 1980's areas that once had high densities are now gone (Smith et al. 1990).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Predation was noted as a threat, for this species, when population numbers dropped in the 1970s (Smith et al. 1990). There are no known major threats at present.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
In Mongolia, approximately 12% of the species' distribution occurs in protected areas (Clark et al. 2006). This species has been regionally Red Listed as Least Concern in Mongolia (Clark et al. 2006). In China, this species has been regionally Red Listed as Least Concern (Wang and Xie 2004).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Alpine pika

The Alpine Pika (Ochotona alpina) is a species of mammal in the Ochotonidae family. It is found in Kazakhstan, Mongolia, and Russia.


References

  1. ^ Smith, A.T. & Johnston, C.H. (2008). Ochotona alpina. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 10 November 2008. Database entry includes a brief justification of why this species is of least concern.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!