Overview
Distribution
Belgian Exclusive Economic Zone, Boulogne, Digue du Nord, De Panne, Dutch Exclusive Economic Zone, European waters (ERMS scope), Gulf of Maine, Irish Exclusive economic Zone, Mediterranean Sea, North West Atlantic, Pointe aux Oies (point), Pointe du Nid de Corbet, Swedish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Wadden Sea, Wimereux, Zeeland
-
Leewis, R. (2002). Flora en fauna van de zee [Marine flora and fauna]. Veldgids, 16. KNNV Uitgeverij: Utrecht, The Netherlands. ISBN 90-5011-153-X. 320 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1116
-
Eneman, E. (1984). Uit het Natuurhistorisch Archief [From the Natural History Archive]. De Strandvlo 4(1): 4-17
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=755
-
Müller, Y. (2004). Faune et flore du littoral du Nord, du Pas-de-Calais et de la Belgique: inventaire. [Coastal fauna and flora of the Nord, Pas-de-Calais and Belgium: inventory]. Commission Régionale de Biologie Région Nord Pas-de-Calais: France. 307 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=9269
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
-
Stegenga, H.; Mol, I. (1983). Flora van de Nederlandse zeewieren [Flora of the Dutch seaweeds]. Natural History Library of the KNNV, 33. Koninklijke Nederlandse Natuurhistorische Vereniging (KNNV): Hoogwoud, The Netherlands. 263 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1270
-
Coppejans, E. (1998). Flora van de Noord-Franse en Belgische zeewieren [Marine algae of northern France and Belgium]. Nationale Plantentuin van België: Meise, Belgium. ISBN 90-72619-41-2. 462 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1236
-
Engledow, H.; Spanoghe, G.; Volckaert, A.; Coppejans, E.; Degraer, S.; Vincx, M.; Hoffmann, M. (2001). Onderzoek naar (1) de fysische karakterisatie en (2) de biodiversiteit van strandhoofden en andere harde constructies langs de Belgische kust: eindrapport van de onderhandse overeenkomst dd. 17.02.2000 i.o.v. de Afdeling Waterwegen Kust van het Ministerie van de Vlaamse Gemeenschap, Departement Leefmilieu en infrastructuur, Administratie Waterwegen en Zeewezen [Research on (1) the physical characterization and (2) the biodiversity of groins and other hard constructions along the Belgian coast: final report]. Rapport Instituut voor Natuurbehoud, 2001.20. Universiteit Gent/Instituut voor Natuurbehoud: Gent & Brussel, Belgium. 110 + annexes pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=756
-
Guiry, M.D. (2001). Macroalgae of Rhodophycota, Phaeophycota, Chlorophycota, and two genera of Xanthophycota, in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 20-38
http://www.marbef.org/data/aphia.php?p=sourcedetails&id=1366
-
MEDIN (2011). UK checklist of marine species derived from the applications Marine Recorder and UNICORN, version 1.0.
http://www.marinespecies.org/asteroidea/aphia.php?p=sourcedetails&id=149081
-
Guiry, M.D. & Guiry, G.M. (2011). Species.ie version 1.0 World-wide electronic publication, National University of Ireland, Galway (version of 15 March 2010).
http://www.marinespecies.org/ascidiacea/aphia.php?p=sourcedetails&id=149068
-
Dyntaxa (2013) Swedish Taxonomic Database. Accessed at www.dyntaxa.se [15-01-2013].
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=165516
Trusted
Long Island Sound to Strait of Belle Isle
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
Trusted
Physical Description
Diagnostic Description
Morphology
Red colour results from the dominance of the pigments phycoerythrin and phycocyanin; this masks the other pigments, chlorophyll a (no chlorophyll b), beta-caratene and a number of unique xanthophylls.
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
Trusted
Ecology
Habitat
Known from the nearshore.
-
Natural Geography in Shore Areas (NaGISA) database, compiled by Ann Knowlton.
http://www.marinespecies.org/arms/aphia.php?p=sourcedetails&id=145467
Trusted
mid-littoral to 10 m in the sublittoral, usually found on rock
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
Trusted
Depth range based on 2 specimens in 1 taxon.
Environmental ranges
Depth range (m): 0 - 0
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Environmental ranges
Depth range (m): 0 - 0
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Porphyra purpurea
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 52 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 52 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
TACCTTATATTTAATTTTTGGTGCATTCTCTGGTGTTCTAGGTGCCTGCGCATCCATATTAATCAGGATGGAGCTAGCCCAACCAGGTAATCAACTCCTTTTAGGTAACCATCAAGTTTATAATGTCTTAGTTACAGAGCACGCTTTTTTAATGATTTTCTTTATGGTAATGCCTGTACTAATAGGAGGGTTTGGTAATTGATTTGTGCCAATTATGATAGGAGCACCAGATATGGCATTCCCTCGATTAAATAACATTAGTTTTTGATTATTACCCCCATCACTATGTCTGCTCTTAGGATCCGCTATGGTTGAAGTAGGGGCAGGCACGGGCTGAACATTGTATCCACCGCTAAGTTCTATTCAAAGTCATTCTGGTGGCGCTGTTGATTTAGCTATCTTTAGTTTGCATTTATCGGGAGCTTCTTCTATACTAGGTGCTATTAACTTCATTACTACTATATTCAACATGCGTAACCCAGGACAAAGTATGTACCGTATCCCATTATTTGTGTGGTCTATCTTAATCACGGCTTTTTTATTGTTACTAGCTGTTCCTGTATTAGCAGGTGCTATTACAATGTTGCTTACCGATAGAAACTTCAATACCACATTTTTCGATCCGTCAGGTGGTGGAGATCCTGTGTTGTATCAACACTTGTTCTGATTCTTTGGACACCCGGAAGTGTACATATTAATATTACCTGGGTTTGGTATTGTTAGCCATATCGTATCTACTTTCTCTCGAAAGCCGGTGTTTGGTTATATAGGTATGATTTATGCTATGCTTTCTATAGGTATTTTAGGATTTATAG
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Porphyra purpurea
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 46
Specimens with Barcodes: 57
Species With Barcodes: 1
Public Records: 46
Specimens with Barcodes: 57
Species With Barcodes: 1
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
