Articles on this page are available in 1 other language: Dutch (1) (learn more)
Overview
Brief Summary
Gracilaria is a bright red or dark brown-black seaweed with typical hard 'knobs' where the reproduction cells are located. It is a typical 'summer seaweed'. The large dark form has been very common on the sandbanks in the Wadden Sea since 1995. It also grows in the delta region. You find it in the zone between high and low tide attached to rocks or gravel. Gracilaria is used for making agar, which is important in the scientific world, particularly for cultivating bacteria or fungi.
© Copyright Ecomare
Source:
Ecomare
Trusted
Comprehensive Description
Description
Thallus terete, rising from a small discoid holdfast terete to 60 cms long. Unbranched or variably branched, irregular. Cystocarps large, to 1 mm in diameter, produding as nodules. Cystoclonium purpureum can be distinguished by its branched holdfast and by the small cells in the centre of the thallus. Rhodomela confervoides shows a large cell in the centre surrounded by about 5 larger cells and others decreasing in size outwards.
© National Museums Northern Ireland and its licensors
Trusted
Distribution
Azores Exclusive Economic Zone, Boulogne, Digue du Nord, European waters (ERMS scope), Irish Exclusive economic Zone, Mediterranean Sea, North Sea, Pointe aux Oies (point), Pointe du Riden, Swedish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Wimereux
-
Müller, Y. (2004). Faune et flore du littoral du Nord, du Pas-de-Calais et de la Belgique: inventaire. [Coastal fauna and flora of the Nord, Pas-de-Calais and Belgium: inventory]. Commission Régionale de Biologie Région Nord Pas-de-Calais: France. 307 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=9269
-
Streftaris, N.; Zenetos, A.; Papathanassiou, E. (2005). Globalisation in marine ecosystems: the story of non-indigenous marine species across European seas. Oceanogr. Mar. Biol. Ann. Rev. 43: 419-453
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=9271
-
Coppejans, E. (1998). Flora van de Noord-Franse en Belgische zeewieren [Marine algae of northern France and Belgium]. Nationale Plantentuin van België: Meise, Belgium. ISBN 90-72619-41-2. 462 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1236
-
Guiry, M.D. (2001). Macroalgae of Rhodophycota, Phaeophycota, Chlorophycota, and two genera of Xanthophycota, in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 20-38
http://www.marbef.org/data/aphia.php?p=sourcedetails&id=1366
-
MEDIN (2011). UK checklist of marine species derived from the applications Marine Recorder and UNICORN, version 1.0.
http://www.marinespecies.org/asteroidea/aphia.php?p=sourcedetails&id=149081
-
Guiry, M.D. & Guiry, G.M. (2011). Species.ie version 1.0 World-wide electronic publication, National University of Ireland, Galway (version of 15 March 2010).
http://www.marinespecies.org/ascidiacea/aphia.php?p=sourcedetails&id=149068
-
Borges, P.A.V., Costa, A., Cunha, R., Gabriel, R., Gonçalves, V., Martins, A.F., Melo, I., Parente, M., Raposeiro, P., Rodrigues, P., Santos, R.S., Silva, L., Vieira, P. & Vieira, V. (Eds.) (2010). A list of the terrestrial and marine biota from the Azores. Princípia, Oeiras, 432 pp.
http://www.marinespecies.org/ascidiacea/aphia.php?p=sourcedetails&id=149079
-
Dyntaxa (2013) Swedish Taxonomic Database. Accessed at www.dyntaxa.se [15-01-2013].
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=165516
© WoRMS for SMEBD
Source:
World Register of Marine Species
Trusted
Widely distributed around the British Isles from the Shetlands to the Channel Islands. Europe: Mediterranean, Portugal, Atlantic coast of Spain, Netherlands, Helgoland, Baltic Sea and Norway. Atlantic coasts of America: from Canada to Brazil. Further afield: Bermuda, Canary Islands, Namibia, South Africa, India and in the Pacific Ocean from British Columbia to Baja California, Philippines and Fiji.
© National Museums Northern Ireland and its licensors
Trusted
Ecology
Habitat
Depth range based on 69 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.
Environmental ranges
Depth range (m): 0 - 23
Temperature range (°C): 11.721 - 11.721
Nitrate (umol/L): 6.816 - 6.816
Salinity (PPS): 35.333 - 35.333
Oxygen (ml/l): 6.095 - 6.095
Phosphate (umol/l): 0.399 - 0.399
Silicate (umol/l): 2.742 - 2.742
Graphical representation
Depth range (m): 0 - 23
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 1 sample.
Environmental ranges
Depth range (m): 0 - 23
Temperature range (°C): 11.721 - 11.721
Nitrate (umol/L): 6.816 - 6.816
Salinity (PPS): 35.333 - 35.333
Oxygen (ml/l): 6.095 - 6.095
Phosphate (umol/l): 0.399 - 0.399
Silicate (umol/l): 2.742 - 2.742
Graphical representation
Depth range (m): 0 - 23
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Common. Epilithic in the lower littoral and sublittoral to 15 m.
© National Museums Northern Ireland and its licensors
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Gracilaria gracilis
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
Download FASTA File
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
AACTTTATATTTAATTTTCGGTGCTTTTTCAGGTATTTTAGGAGGTTGTATGTCAATATTAATCCGTATGGAATTAACACAACCCGGAAACCAATTATTATTGGGAAATCATCAGATTTATAACGTCTTAATTACAGCACATGCATTTTTAATGATTTTTTTTATGGTAATGCCTGTTATGATAGGTGGGTTTGGTAATTGATTAGTACCCATTATGATCGGGAGTCCAGATATGGCTTTTCCACGTTTAAACAATATATCATTTTGATTATTACCGCCTTCATTATGTTTACTTTTAGCGTCTGCAATTGTAGAAGTTGGTGTAGGGACTGGATGGACGGTGTACCCTCCATTAAGTTCAATCCAAAGTCATTCAGGTGGTGCAGTAGATCTTGCAATATTTAGTTTACATATATCAGGAGCTTCATCAATCTTAGGTGCAATTAATTTTATATCTACAATCTTAAATATGCGCAATCCTGGGCAAAGCATGTATCGTATGCCATTATTTGTGTGATCTATTTTTATCACGGCGTTCTTATTATTATTAGCTGTTCCAGTTTTAGCTGGTGCCATTACGATGCTTTTAACTGATCGTAATTTCAATACAGCATTCTTTGACCCTGCCGGTGGAGGTGATCCCGTATTGTATCAGCACCTTTTTTGATTTTTTGGGCATCCTGAAGT
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Gracilaria gracilis
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 8
Species With Barcodes: 1
Public Records: 1
Specimens with Barcodes: 8
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
