Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

Irish moss is a red seaweed found in large colonies on stones and rocks in shallow water. Irish moss is also called carragheen, because it contains so much carrageenan. Carrageenan is used as a thickener and stabilizer in many products, including ice cream and lunch meats. The Scots use this seaweed for making a kind of tapioca pudding. The seaweed is found in the Atlantic Ocean and adjoining waters, such as the North Sea and parts of the Baltic Sea.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

 Chondrus crispus is a small purplish-red seaweed (up to 22 cm long) found on rocky shores and in pools. The fronds grow dichotomously from a narrow, unbranched stipe and are flat and wide with rounded tips. This seaweed is highly variable in appearance depending on the level of wave exposure of the shore and has a tendency to turn green in strong sunlight. Underwater, the tips of the frond can be iridescent.Also known as Irish moss. Together with Mastocarpus stellatus, Chondrus crispus is harvested commercially as carrageen to be used in the pharmaceutical and food industries. May be confused with Mastocarpus stellatus, although the latter species has a rounded stipe, channeled fronds and papillate reproductive bodies.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Grows from a discoid holdfast forming erect fronds to a maximum of 20 cms long. Flattened and dichotomously branching 3 or 4 times in fan-like manner. Very variable. Mastocarpus stellatus has a channelled frond and reproduces with cystocarps which arise as short papillae.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Widespread around the British Isles including the Shetlands. Europe: Azores, Portugal, Spain, France, Netherlands, Norway and Iceland. Atlantic coast of North America: Canada and the United States from Maine to Delaware.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Atlantic, Canada, De Panne, Dutch Exclusive Economic Zone, European waters (ERMS scope), Grevelingen, Gulf of Maine, Irish Exclusive economic Zone, North West Atlantic, Oostduinkerke, Oostende, Pointe du Nid de Corbet, Pointe du Riden, Portugal, Swedish Exclusive Economic Zone, United Kingdom, United Kingdom Exclusive Economic Zone, USA, Wadden Sea, Wimereux, Zeebrugge, Zeeland
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Long Island Sound to Strait of Belle Isle
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Diagnostic Description

Morphology

Red colour results from the dominance of the pigments phycoerythrin and phycocyanin; this masks the other pigments, chlorophyll a (no chlorophyll b), beta-caratene and a number of unique xanthophylls.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

low littoral, tide pools and sublittoral to 20 m; also on exposed coasts and on cobble in semi-protected sites
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known from rocky shores.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 407 specimens in 1 taxon.
Water temperature and chemistry ranges based on 38 samples.

Environmental ranges
  Depth range (m): 0 - 34.75
  Temperature range (°C): 11.471 - 12.348
  Nitrate (umol/L): 4.729 - 7.121
  Salinity (PPS): 35.008 - 35.363
  Oxygen (ml/l): 6.069 - 6.346
  Phosphate (umol/l): 0.335 - 0.439
  Silicate (umol/l): 2.315 - 3.727

Graphical representation

Depth range (m): 0 - 34.75

Temperature range (°C): 11.471 - 12.348

Nitrate (umol/L): 4.729 - 7.121

Salinity (PPS): 35.008 - 35.363

Oxygen (ml/l): 6.069 - 6.346

Phosphate (umol/l): 0.335 - 0.439

Silicate (umol/l): 2.315 - 3.727
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 Abundant on rocks on the middle to lower rocky shore and in tide pools. It occurs sublittorally to 24 m. It can tolerate some reduction in salinity and can be found in estuaries.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Very common. Epilithic in midlittoral rock pools into the sublittoral to 24 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

In Great Britain and/or Ireland:
Foodplant / parasite
immersed pycnidium of anamorph of Lautitia danica parasitises blackened cystocarpic pustule of Chondrus crispus

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chondrus crispus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TACTCTTTATCTAATTTTCGGTGCTTTTTCAGGTGTTTTAGGTGGATGCATGTCAATGTTAATTCGTATGGAGTTAGCTCAACCCAGTAACCATTTACTCTTAGGAAATCACCAAATTTACAATGTTCTTATAACAGCTCATGCATTTCTTATGATTTTTTTTATGGTTATGCCTGTAATGATTGGTGGGTTTGGAAATTGATTAGTTCCAATAATGATTGGTAGCCCAGATATGGCTTTCCCGCGATTAAATAATATTTCATTTTGATTATTACCTCCTTCTTTATGCTTATTACTTATGTCAGCACTTGTTGAAGTAGGTGTTGGTACTGGATGAACTGTTTATCCACCACTTAGCTCAATTCAAAGTCATTCAGGTGGTGCTGTAGATTTAGCAATTTTTAGTCTTCATATATCAGGTGCTTCTTCAATCTTAGGAGCTGTAAATTTTATTTCTACTATTTTAAATATGAGAAGTCCTGGACAGAGTATGTATAGAATTCCTCTTTTTGTTTGATCAATACTTGTAACAGCATTTTTACTTTTATTGGCAGTTCCTGTTTTAGCAGGAGCTATTACAATGCTTTTAACTGATCGTAATTTCAATACTTCTTTCTTTGATGCATCAGGTGGAGGAGATCCAATTTTATACCAACATTTGTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Chondrus crispus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 61
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 5 specimens with morphological vouchers housed at Australia Museum and Australian Museum
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Chondrus crispus

Chondrus crispus — commonly called Irish moss or carrageen moss (Irish carraigín, "little rock") — is a species of red algae which grows abundantly along the rocky parts of the Atlantic coast of Europe and North America. In its fresh condition this protist is soft and cartilaginous, varying in color from a greenish-yellow, through red, to a dark purple or purplish-brown. The principal constituent is a mucilaginous body, made of the polysaccharide carrageenan which comprises about 55% by weight. The organism also consists of nearly 10% protein and about 15% mineral matter, and is rich in iodine and sulfur. When softened in water it has a sea-like odour and because of the abundant cell wall polysaccharides it will form a jelly when boiled, containing from 20 to 100 times its weight of water.

Contents

Description

Chondrus crispus is a relatively small red alga, reaching up to a little over than 20 cm in length. It grows from a discoid holdfast and branches four or five times in a dichotomous, fan-like manner. The morphology is highly variable, especially the broadness of the thalli. The branches are 2–15 mm broad, firm in texture and dark reddish brown in color bleaching to yellowish in sunlight. The gametophytes (see below) often show a blue iridescence and fertile sporophytes show a spotty pattern. Mastocarpus stellatus (Stackhouse) Guiry is a similar species which can be readily distinguished by its strongly channelled and often somewhat twisted thallus. The cystocarpic plants of Mastocarpus show reproductive papillae[clarification needed] quite distinctively different from Chondrus.[1] When washed and sun-dried for preservation, it has a yellowish, translucent, horn-like aspect and consistency.

Distribution

Chondrus crispus is common all around the shores of Ireland and Great Britain and can also be found along the coast of Europe including Iceland, the Faroe Islands [2] western Baltic Sea to southern Spain.[1] It is found on the Atlantic coasts of Canada[1][3] and recorded from California in the United States to Japan.[1] However, any distribution outside the Northern Atlantic needs to be verified. There are also other species of the same genus in the Pacific Ocean, for example, C. ocellatus Holmes, C. nipponicus Yendo, C. yendoi Yamada et Mikami, C. pinnulatus (Harvey) Okamura and C. armatus (Harvey) Yamada et Mikami.[4]

Ecology

Chondrus crispus is found growing on rock from the middle intertidal zone into the subtidal zone.

Uses

The life cycle of Chondrus crispus. Below the life stage are indicated if the life stage is haploid(n) or diploid (2n) and the type of carrageenan present.
How the life cycles of Chondrus crispus might look in nature. The gametophytes show blue iridescence and the fertile sporophytes exhibit a spotty pattern.

Chondrus crispus is an industrial source of carrageenan, which is commonly used as a thickener and stabilizer[5] in milk products such as ice cream[6] and processed foods, including lunch meat. In Europe, it is indicated as E407 or E407b. It may also be used as a thickener in calico-printing and for fining beer or wine. Irish moss is frequently mixed with Mastocarpus stellatus (Gigartina mammillosa), Chondracanthus acicularis (G. acicularis) and other seaweeds with which it is associated in growth. Carrageenan and agar-agar are also used in Asia for gelatin-like desserts, such as almond jelly. Presently, the major source of carrageenan is tropical seaweeds of the genera Kappaphycus and Eucheuma.[7]

In parts of Scotland (where it is known as (An) Cairgean in Scottish Gaelic) and Ireland, it is boiled in milk and strained, before sugar and other flavourings such as vanilla, cinnamon, brandy or whisky are added.[8] The end-product is a kind of jelly similar to pannacotta, tapioca, or blancmange.[9] Similarly, in Trinidad and Tobago Gracilaria spp is boiled with cinnamon and milk to make a thick drink called Irish Moss that is believed to be an aphrodisiac.[10] In Venezuela it has been used for generations as a home remedy for sore throat and chest congestion, boiled in milk and served with honey before bed.

Irish moss is commonly used as a clarifying agent in the process of brewing (beer), particularly in homebrewing. A small amount is boiled with the wort, attracting proteins and other solids, which is then removed from the mixture after cooling.

Life history

Chondrus crispus undergoes an alternation of generation life cycle common in many species of algae (see figure below). There are two distinct stages: the sexual haploid gametophyte stage and the asexual diploid sporophyte stage. In addition, there is a third stage- the carposporophyte, which is formed on the female gametophyte after fertilization. The male and female gametophytes produce gametes which fuse to form a diploid carposporophyte, which forms carpospores, which develops into the sporophyte. The sporophyte then undergoes meiosis to produce haploid tetraspores (which can be male or female) that develop into gametophytes. The three stages (male, female and sporophyte) are difficult to distinguish when they are not fertile; however, the gametophytes often show a blue iridescence.

Scientific interest

The portion of the 65th plate of Ernst Haeckel's Kunstformen der Natur (1904), depicting Florideae Chondrus crispus, i.e. Irish moss.
When cultured in the laboratory Chondrus can have a morphology similar to the Haeckel plate; however, this is rarely seen in nature.
Seaweed, irishmoss, raw
Nutritional value per 100 g (3.5 oz)
Energy205 kJ (49 kcal)
Carbohydrates12.29 g
- Sugars0.61 g
- Dietary fiber1.3 g
Fat0.16 g
Protein1.51 g
Riboflavin (vit. B2)0.466 mg (39%)
Niacin (vit. B3)0.593 mg (4%)
Pantothenic acid (B5)0.176 mg (4%)
Vitamin B60.069 mg (5%)
Folate (vit. B9)182 μg (46%)
Vitamin C3 mg (4%)
Vitamin E0.87 mg (6%)
Vitamin K5 μg (5%)
Calcium72 mg (7%)
Iron8.9 mg (68%)
Magnesium144 mg (41%)
Manganese0.37 mg (18%)
Phosphorus157 mg (22%)
Sodium61 mg (4%)
Zinc1.95 mg (21%)
Link to USDA Database entry
Percentages are relative to
US recommendations for adults.
Source: USDA Nutrient Database

Chondrus crispus is, compared to most other seaweeds, well-investigated scientifically. It has been used as a model species to study photosynthesis, carrageenan biosynthesis, and stress responses.The nuclear genome was sequenced in 2013.[11] It was first example of complete genome sequence of a red macroalga. The genome size is 105 Mbp and is coding for 9,606 genes. It is characterised by relatively few genes with very few introns. The genes are clustered together, with normally short distances between genes and then large distances between groups of genes.

Names in various languages

LanguageNames
Bretonpioka, liken ruz, teil piko, bouch, bouchounoù, bejin behan, bejin gwenn, bouch farad youd, bouch gad, bouch gwenn, jargod, ougnachou-ru, teles, tilez
Catalanmolsa d’Irlanda, molsa marina o molsa perlada
DanishCarrageentang, Blomkålstang, Irlandsk mos
DutchIers mos
EnglishIrish moss, pearl moss, carrageen moss, seamuisin, curly moss, curly gristle moss, Dorset weed, jelly moss, sea moss, white wrack, ragglus fragglus
FaroeseKarrageentari
Filipinogulaman
Frenchpetit goémon, mousse d’Irlande, lichen (carraghèen), goémon frisé, goémon blanc, goémon rouge, mousse perlée
Galicianouca riza, carrapucho, creba, pata de galiña
GermanIrisch Moos, Knorpeltang, Carrageen, Irländischer Perltang, Irländisches Moos, Karragaheen, Perlmoos
HungarianÍr moszat
IcelandicFjörugrös
Irishcarraigín, fiadháin, clúimhín cait, mathair an duilisg, ceann donn
Italianmuschio irlandese
Japanesehirakotoji, tochaka, tsunomata
Norwegiankrusflik, driesflik, gelatintang
Polishchrząstnica, chrząścica
Portuguesemusgo gordo, musgo irlandês, carragina, folha de alface, folhina, botelho crespo
Russianирландский мох, карраген
Scottish (Gaelic)An cairgein, killeen, mathair an duilisg
Spanishmusgo de Irlanda, musgo perlado, musgo marino, carrageen, liquen, liquen gomoso
Swedishkarragenalg (karragentång)[12]
Turkishkarragen
UrduPathar ka phool
Welshmwsog Iwerddon

See also

Harvey, M.J. & McLachlan, J. 1973. Chondrus crispus. Proc. Trans. Nova Scotian Inst. Sci. 27 (Suppl.): 1 - 155.

References

  1. ^ a b c d P. S. Dixon & L. M. Irvine (1977). Seaweeds of the British Isles. Vol. 1 Rhodophyta Part 1: Introduction, Nemaliales, Gigartinales. British Museum (Natural History) London. ISBN 0-565-00781-5. 
  2. ^ F. Börgesen (1903). "Marine Algae of the Faröes". Botany of the Faröes based upon Danish investigations Part II (Copenhagen Reprint 1970). p. 35. ISBN 90-6105-011-1. 
  3. ^ W. R. Taylor (1972). Marine Algae of the Northeastern Coast of North America. University of Michigan Press, Ann Arbor. ISBN 0-472-04904-6. 
  4. ^ Hu, Z., Critchley, A.T., Gao T, Zeng X, Morrell, S.L. and Delin, D. 2007 Delineation of Chondrus (Gigartinales, Florideophyceae) in China and the origin of C. crispus inferred from molecular data. Marine Biology Research, 3: 145-154
  5. ^ Roeck-Holtzhauer, Y.de 1991. Uses of seaweeds in Cosmetics. in Guiry, M.D. and Blunden, G. 1991 Seaweed Resources in Europe: Uses and Potential. John Wiley & Sons ISBN 0-471-92947-6
  6. ^ Stegenga, H., Bolton, J.J., and Anderson, R.J. 1997. Seaweeds of the South African West Coast. ed. Hall, A.V. Bolus Herbarium Number 18 Cape Town. ISBN 0-7992-1793-X
  7. ^ Bixler, H. J., & Porse, H. (2011). A decade of change in the seaweed hydrocolloids industry. Journal of Applied Phycology, 23 ,321-335
  8. ^ Feum à Feamainn (DVD, Scottish Gaelic), Comhairle nan Eilean Siar
  9. ^ [1] Lusan a' Chladaich (Western Isles Council, Scottish Gaelic site)
  10. ^ Sylvia A Mitchell. The Jamaican root tonics: a botanical reference. Focus on Alternative and Complementary Therapies. Volume 16, Issue 4, pages 271–280, December 2011
  11. ^ Collén J, et al (2013) Genome structure and metabolic features in the red seaweed Chondrus crispus shed light on evolution of the Archaeplastida. Proceedings of the National Academy of Sciences doi:10.1073/pnas.1221259110.
  12. ^ Willén, T. & M. Waern, 1987. Alger med svenska namn. Svensk botanisk tidskrift 81: 281-288.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!