Overview

Distribution

Range Description

This species is endemic to the United States. The eastern segment of the range (subspecies longicaudus) encompasses the southeastern United States, from Virginia and Kentucky to the Gulf Coast and southern Florida, east of the Mississippi River; the western part of the range (subspecies attentuatus) extends from southeastern Nebraska, Iowa, Wisconsin, and Indiana south to the Gulf Coast of Texas and Louisiana, west of the Mississippi River in the south (Conant and Collins 1991).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Ophisaurus attenuatus is found in the U.S., from central Illinois west into central Kansas

and south through eastern Texas, extending across the Mississippi into southern Florida

and up to east North Carolina and southeast Virginia. There are isolated occurences in

central Wisconsin. The two subspecies are separated by the

Mississippi, with O. a. attenuatus in the west and O. a. longicaudus in

the east (Conant and Collins, 1998).

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (200,000 to >2,500,000 square km (about 80,000 to >1,000,000 square miles)) The eastern segment of the range (subspecies longicaudus) encompasses the southeastern United States, from Virginia and Kentucky to the Gulf Coast and southern Florida, east of the Mississippi River; the western part of the range (subspecies attentuatus) extends from southeastern Nebraska, Iowa, Wisconsin, and Indiana south to the Gulf Coast of Texas and Louisiana, west of the Mississippi River in the south (Conant and Collins 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Continent: North-America
Distribution: USA (E Texas, Oklahoma, E Kansas, SE Nebraska, S/E Iowa, Missouri, Arkansas, Louisiana, Mississippi, Alabama, Georgia, Florida, South Carolina, North Carolina, Tennessee, SW Kentucky, SE Virginia, Illinois, S Wisconsin)  attenuatus: West of Mississippi, Illinois.
Type locality: Texas  longicaudus: SE Virginia to S Florida, west to the Mississippi, northward to Kentucky.  sulcatus:
Type locality: Dallas, Texas
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Peter Uetz

Source: The Reptile Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Ophisourus attenuatus is approximately 22-42 inches long with an extremely long tail which can be up to two and a half times longer than that of head and body combined. This lizard has

large, plate-like scales that have bony plates called osteoderms under them, causing the lizard feel stiff when handled (Harding, 1997). There are lateral grooves, which appear as a small groove on either side of the lizard, approximately one-third up from the venter. Legs are completely absent and external ears are visible (University of Texas, 1999).

Upon first inspection, many people believe that O. attenuatus is a snake. But its pointed snout, stiff body scales and movable eyelids will distinguish this legless lizard from

all snakes.

Color varies from brown, tannish bronze to pale yellow with a dark middorsal stripe that is dark brown to black with two lateral stripes below the lateral groves. The side of the

head has scattered brown markings and the underside is white to a pale yellow (Wisconsin,1999).

The two subspecies can be distinguished by proportions and size. Ophisaurus a. attenuatus has a tail less than 2.4 times the length of the body while O. a.longicaudus has a tail more than 2.4 times the length of the rest of the body and is, on average,larger in overall length.

Sexes can be hard to distinguish with males having slightly wider heads and a longer average length. Juveniles can be distinguished by their more contrasting colors (Harding,

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 107 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paratype for Ophisaurus attenuatus longicaudus
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: Georgiana, Brevard, Florida, United States, North America
  • Paratype: McConkey, E. H. 1952. Natural History Miscellanea. (102): 1.; McConkey, E. H. 1954. A systematic study of the North American lizards of the genus Ophisaurus. The American Midland Naturalist. 51 (1): 133-171.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Ophisaurus attenuatus longicaudus
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: Knoxville, Knox, Tennessee, United States, North America
  • Paratype: McConkey, E. H. 1952. Natural History Miscellanea. (102): 1.; McConkey, E. H. 1954. A systematic study of the North American lizards of the genus Ophisaurus. The American Midland Naturalist. 51 (1): 133-171.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Ophisaurus attenuatus longicaudus
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1903
Locality: Aiken, South Carolina, United States, North America
  • Paratype: McConkey, E. H. 1952. Natural History Miscellanea. (102): 1.; McConkey, E. H. 1954. A systematic study of the North American lizards of the genus Ophisaurus. The American Midland Naturalist. 51 (1): 133-171.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Ophisaurus attenuatus longicaudus
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: Ashland, 3 mi W of, Hanover, Virginia, United States, North America
  • Paratype: McConkey, E. H. 1952. Natural History Miscellanea. (102): 1.; McConkey, E. H. 1954. A systematic study of the North American lizards of the genus Ophisaurus. The American Midland Naturalist. 51 (1): 133-171.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Ophisaurus attenuatus longicaudus
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1932
Locality: Jedburg, Dorchester, South Carolina, United States, North America
  • Paratype: McConkey, E. H. 1952. Natural History Miscellanea. (102): 1.; McConkey, E. H. 1954. A systematic study of the North American lizards of the genus Ophisaurus. The American Midland Naturalist. 51 (1): 133-171.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Ophisaurus attenuatus longicaudus
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: Gulfport, Pinellas, Florida, United States, North America
  • Paratype: McConkey, E. H. 1952. Natural History Miscellanea. (102): 1.; McConkey, E. H. 1954. A systematic study of the North American lizards of the genus Ophisaurus. The American Midland Naturalist. 51 (1): 133-171.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Ophisaurus attenuatus longicaudus
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: Cleveland, Bradley, Tennessee, United States, North America
  • Paratype: McConkey, E. H. 1952. Natural History Miscellanea. (102): 1.; McConkey, E. H. 1954. A systematic study of the North American lizards of the genus Ophisaurus. The American Midland Naturalist. 51 (1): 133-171.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Ophisaurus attenuatus longicaudus
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1915
Locality: Dunedin, Pinellas, Florida, United States, North America
  • Paratype: McConkey, E. H. 1952. Natural History Miscellanea. (102): 1.; McConkey, E. H. 1954. A systematic study of the North American lizards of the genus Ophisaurus. The American Midland Naturalist. 51 (1): 133-171.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Ophisaurus attenuatus longicaudus
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: Eustis, Lake, Florida, United States, North America
  • Paratype: McConkey, E. H. 1952. Natural History Miscellanea. (102): 1.; McConkey, E. H. 1954. A systematic study of the North American lizards of the genus Ophisaurus. The American Midland Naturalist. 51 (1): 133-171.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Ophisaurus attenuatus longicaudus
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: Eustis, Lake, Florida, United States, North America
  • Paratype: McConkey, E. H. 1952. Natural History Miscellanea. (102): 1.; McConkey, E. H. 1954. A systematic study of the North American lizards of the genus Ophisaurus. The American Midland Naturalist. 51 (1): 133-171.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Ophisaurus attenuatus longicaudus
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: Chuckatuck, Suffolk (city), Virginia, United States, North America
  • Paratype: McConkey, E. H. 1952. Natural History Miscellanea. (102): 1.; McConkey, E. H. 1954. A systematic study of the North American lizards of the genus Ophisaurus. The American Midland Naturalist. 51 (1): 133-171.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Ophisaurus attenuatus longicaudus
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Sex/Stage: ; Juvenile
Preparation: Ethanol
Locality: No Further Locality Data, Florida, United States, North America
  • Paratype: McConkey, E. H. 1952. Natural History Miscellanea. (102): 1.; McConkey, E. H. 1954. A systematic study of the North American lizards of the genus Ophisaurus. The American Midland Naturalist. 51 (1): 133-171.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Ophisaurus attenuatus longicaudus
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: No Further Locality Data, Mississippi, United States, North America
  • Paratype: McConkey, E. H. 1952. Natural History Miscellanea. (102): 1.; McConkey, E. H. 1954. A systematic study of the North American lizards of the genus Ophisaurus. The American Midland Naturalist. 51 (1): 133-171.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Ophisaurus attenuatus longicaudus
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: No Further Locality Data, Georgia, United States, North America
  • Paratype: McConkey, E. H. 1952. Natural History Miscellanea. (102): 1.; McConkey, E. H. 1954. A systematic study of the North American lizards of the genus Ophisaurus. The American Midland Naturalist. 51 (1): 133-171.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Ophisaurus attenuatus longicaudus
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1879
Locality: Clearwater, Pinellas, Florida, United States, North America
  • Paratype: McConkey, E. H. 1952. Natural History Miscellanea. (102): 1.; McConkey, E. H. 1954. A systematic study of the North American lizards of the genus Ophisaurus. The American Midland Naturalist. 51 (1): 133-171.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Ophisaurus attenuatus longicaudus
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: New Smyrna, Volusia, Florida, United States, North America
  • Paratype: McConkey, E. H. 1952. Natural History Miscellanea. (102): 1.; McConkey, E. H. 1954. A systematic study of the North American lizards of the genus Ophisaurus. The American Midland Naturalist. 51 (1): 133-171.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Ophisaurus attenuatus longicaudus
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1922
Locality: Eustis, near, Lake, Florida, United States, North America
  • Paratype: McConkey, E. H. 1952. Natural History Miscellanea. (102): 1.; McConkey, E. H. 1954. A systematic study of the North American lizards of the genus Ophisaurus. The American Midland Naturalist. 51 (1): 133-171.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Ophisaurus attenuatus longicaudus
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1924
Locality: Smithsonia, Lauderdale, Alabama, United States, North America
  • Paratype: McConkey, E. H. 1952. Natural History Miscellanea. (102): 1.; McConkey, E. H. 1954. A systematic study of the North American lizards of the genus Ophisaurus. The American Midland Naturalist. 51 (1): 133-171.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Ophisaurus attenuatus longicaudus
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Locality: Rockwood, Roane, Tennessee, United States, North America
  • Paratype: McConkey, E. H. 1952. Natural History Miscellanea. (102): 1.; McConkey, E. H. 1954. A systematic study of the North American lizards of the genus Ophisaurus. The American Midland Naturalist. 51 (1): 133-171.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Ophisaurus attenuatus longicaudus
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1883
Locality: Mt. Mourne, Iredell, North Carolina, United States, North America
  • Paratype: McConkey, E. H. 1952. Natural History Miscellanea. (102): 1.; McConkey, E. H. 1954. A systematic study of the North American lizards of the genus Ophisaurus. The American Midland Naturalist. 51 (1): 133-171.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Ophisaurus attenuatus longicaudus
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles
Preparation: Ethanol
Year Collected: 1891
Locality: Greenville, South Carolina, United States, North America
  • Paratype: McConkey, E. H. 1952. Natural History Miscellanea. (102): 1.; McConkey, E. H. 1954. A systematic study of the North American lizards of the genus Ophisaurus. The American Midland Naturalist. 51 (1): 133-171.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Amphibians & Reptiles

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Habitats include open grassland, prairie, woodland edge, open woodland, oak savannas, longleaf pine flatwoods, scrubby areas, fallow fields, and areas near streams and ponds, often in habitats with sandy soil. This species often appears on roads in spring. During inactivity, it occurs in underground burrows. In Kansas, slender glass lizards were scarce in heavily grazed pastures, increased as grass increased with removal of grazing, and declined as brush and trees replaced grass (Fitch 1989). Eggs are laid underground, under cover, or under grass clumps (Ashton and Ashton 1985); in cavities beneath flat rocks or in abandoned tunnels of small mammals (Scalopus, Microtus) (Fitch 1989).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Found in a variety of habitats within its range including dray grasslands, wooded areas, oak savannas, sand praries, old fields and pine barrens (Wisconsin, 1999).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Habitats include open grassland, prairie, woodland edge, open woodland, oak savannas, longleaf pine flatwoods, scrubby areas, fallow fields, and areas near streams and ponds, often in habitats with sandy soil. This species often appears on roads in spring. During inactivity, it occurs in underground burrows. In Kansas, slender glass lizards were scarce in heavily grazed pastures, increased as grass increased with removal of grazing, and declined as brush and trees replaced grass (Fitch 1989).

Eggs are laid underground, under cover, or under grass clumps (Ashton and Ashton 1985); in cavities beneath flat rocks or in abandoned tunnels of small mammals (Scalopus, Microtus) (Fitch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

This species is carnivorous, and will eat just about any small animal that it finds that will fit in its mouth. This includes beetles, grasshoppers, crickets, spiders and small vertebrates.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats insects, spiders, snails, reptile and bird eggs, and occasionally mice and possibly other small vertebrates. Forages on ground and underground (Vogt 1981). In Kansas, finds prey partly by olfaction; diet is mainly grasshoppers, crickets, katydids, beetles, and spiders (Fitch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: Many occurences.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 - 1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Kansas: tends to stay in familiar area, but home range is not well defined; adult males range more widely than do females and immatures; average home range is about 0.44 ha in adult males, 0.14 ha in juveniles; peak density is about 100 per ha; important predators include carnivores, hawks, and snakes; annual mortality is about 40% in adults and adolescents (Fitch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Active from May to late September in the north (Vogt 1981), longer in the south. Fall activity primarily is by hatchlings (Vogt 1981). In Arkansas, peak in activity occurs from April to early June (Trauth 1984). Mostly diurnal, but occasionally crepuscular or nocturnal; in Kansas, surface activity is elicited by warm summer rains (Fitch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Mating occurs throughout May with the female laying her clutch in June or early in July (Harding, 1997). The female then exhibits brooding in which the body temperature will rise 0.3-0.4 degrees Celsius and she will incubate the eggs (Glass Lizard, 1999). The young will hatch out after 50-60 days and grow quickly to maturity (Harding, 1997).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In Kansas, mating occurs in May. Lays clutch of 3-17 (average 12 in Arkansas, 10 in Kansas) eggs in June or July (usually first week of July in Kansas). Female stays with eggs until hatching in late summer, after 7-8 weeks in Kansas. Sexually mature in 2 years (Arkansas, Trauth 1984) or 3-4 years (Fitch 1970, Fitch 1989). In Kansas, individual females do not breed every year (Fitch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ophisaurus attenuatus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBGC5244-08|EU747729|Ophisaurus attenuatus| ACTCGCTGACTATTTTCTACTAACCACAAAGACATCGGAACTCTCTACCTAATTTTTGGGGCCTGGGCCGGCATGGTCGGAACCGCCTTA---AGCCTTTTAATTCGCGCAGAACTAAGCCAGCCCGGGGCCCTCCTGGGAGAC---GACCAGATCTATAACGTGGTTGTGACTGCCCACGCCTTTGTAATAATCTTCTTCATGGTTATGCCTATTATGATCGGCGGATTCGGAAACTGATTGGTCCCCCTAATA---ATTGGGGCCCCTGACATAGCGTTCCCACGAATAAACAACATAAGCTTCTGACTCTTACCCCCTTCCCTTCTTCTTCTATTAGCCTCCTCGGGCGTAGAGGCCGGTGCTGGAACCGGGTGAACAGTATACCCCCCCCTTGCCGGAAATCTGGCTCACGCCGGGGCCTCCGTTGACTTA---ACCATCTTCTCCCTCCATCTAGCCGGAGTTTCCTCCATCCTAGGAGCAATTAACTTCATCACGACCTGCATCAATATAAAACCCCCATCTATATCTCAATATCAAACCCCCCTATTTGTATGATCCGTTATAATTACTGCAGTTCTTCTCCTCCTGTCCCTGCCCGTACTGGCTGCA---GGTATTACTATACTATTAACAGACCGCAACCTTAACACATCATTCTTTGACCCCGCCGGAGGAGGAGACCCCATCCTATACCAACACCTGTTCTGATTCTTCGGCCACCCAGAAGTATACATCCTAATCTTGCCGGGGTTTGGCATAATCTCCCACATTGTGACATACTATGCCGGCAAAAAA---GAGCCGTTCGGGTACATAGGCATAGTCTGAGCAATAGTATCTATTGGCTTTTTGGGGTTCATCGTATGAGCCCACCATATATTTACCGTTGGAATAG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ophisaurus attenuatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 1
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2007

Assessor/s
Hammerson, G.A.

Reviewer/s
Cox, N., Chanson, J.S. & Stuart, S.N. (Global Reptile Assessment Coordinating Team)

Justification
Listed as Least Concern in view of the extensive geographic distribution and many relatively stable populations. Historically, regional declines occurred as a result of agricultural development, but currently the overall extent of occurrence, area of occupancy, and abundance are probably relatively stable.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

In Wisconsin, the Ophisaurus attenuatus has an endangered status, but for the rest of the U.S., there is no special status (Wisconsin, 1999).

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Globally secure, largely on the basis of the extensive range.

Intrinsic Vulnerability: Moderately vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This lizard is represented by a large number of populations, and it is locally common in many areas. Its area of occupancy and abundance have probably declined, but the species remains widespread.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Global Long Term Trend: Increase of 10-25% to decline of 50%

Comments: Historically, regional declines occurred as a result of agricultural development, but currently the overall extent of occurrence, area of occupancy, and abundance are probably relatively stable.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Conversion of habitat to human uses, especially intensive agriculture, is probably the major threat, but the species is reasonably secure throughout most of its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Conversion of habitat to human uses, especially intensive agriculture, is probably the major threat.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species occurs in many protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management Requirements: Burning, cutting, and thinning are management practices that may be appropriate for maintaining open habitat.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Very many (>40) occurrences appropriately protected and managed

Comments: This species occurs in many protected areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Slender glass lizard

The Slender Glass Lizard, (Ophisaurus attenuatus) is a legless lizard which can attain a length of up to 1 meter. Two subspecies are recognised.

Contents

Subspecies

Description

Slender glass lizards have a yellow to brown body with six stripes and lateral grooves. Unlike snakes, they have eyelids and ears.

Geographic distribution

This glass lizard is mainly found in the eastern half of the United States, from as far north as Wisconsin across to Virginia, south to Florida, and west to Texas in grasslands or open woodlands.

Behavior

Slender glass lizards are diurnal, so they are quite often seen, but they can move fast (with a serpentine movement like that of a snake). If captured, a specimen may thrash vigorously, causing part of the tail to fall off in one or more pieces. While a potential predator is distracted by the wiggling tail, the lizard quickly escapes. They sleep in burrows borrowed from other animals, and in the northern reaches of its range, slender glass lizards will use those burrows to hibernate through the winter.

Diet

They eat a range of insects, such as grasshoppers, crickets and beetles, and will also consume spiders, small mice, snails, and the eggs of other reptiles and ground-nesting birds. Unlike snakes, glass lizards do not have flexible jaws, and this limits the size of prey items they can consume. They forage both above ground and underground in burrows.

Reproduction

Mating typically occurs bi-annually, in mid-spring. The female lays and broods a clutch averaging 12 eggs in June or July. Eggs hatch 50–60 days after being laid. Hatchlings are 10–13 cm in length. Sexual maturity is attained at two or three years of age.

Conservation status

Although not endangered overall in the US, it is regarded as vulnerable or endangered in some states. Primary threats are loss of habitat, and the fragmentation of what remains by human development.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Prior to 1954 (McConkey 1954), all glass lizards (including species now known as Ophisaurus attentuatus, O. compressus, and O. mimicus) were referred to as Ophisaurus ventralis. Palmer (1987) described O. mimicus as a distinct species. Subspecies longicaudus was proposed as a distinct species by Collins (1991), who expressed the opinion that any allopatric subspecies that is in some way morphologically distinct should be treated as a distinct species, but most authors maintain longicaudus as a subspecies of O. attenuatus.

Molecular data support recognition of the family Anniellidae and anguid subfamilies Gerrhonotinae and Anguinae as monophyletic groups (Macey et al. 1999). Within the Anguinae, Ophisaurus apparently is not monophyletic; among various taxonomic alternatives available to remedy the situation, Macey et al. (1999) favored placing all members of the subfamily in a single genus (Anguis).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!