Ecology

Associations

Animal / parasitoid / endoparasitoid
larva of Wagneria gagatea is endoparasitoid of larva of Drymonia ruficornis

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Drymonia ruficornis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 20
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Drymonia ruficornis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGAATTTGAGCTGGTATAGTAGGAACTTCCCTAAGATTATTAATTCGAGCAGAATTAGGAAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACTGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTCCCTTTAATATTAGGAGCCCCTGATATAGCCTTCCCCCGAATAAATAATATAAGATTTTGATTGCTCCCACCCTCTTTAACTTTATTAATTTCAAGTAGTATCGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCCCCATTATCTTCTAATATTGCACACGGAGGAAGTTCAGTAGATTTAGCAATTTTTTCATTACATTTAGCTGGAATTTCCTCAATCTTAGGGGCTATTAATTTCATTACAACAATTATTAATATACGACTTAATGGTATATCTTTCGACCAAATACCTTTATTTGTGTGAGCCGTAGGAATTACAGCATTTTTACTTCTCCTATCTTTACCAGTATTAGCAGGAGCAATTACAATATTATTAACTGATCGAAATCTAAATACCTCATTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Drymonia ruficornis

The Lunar Marbled Brown (Drymonia ruficornis) is a moth of the family Notodontidae. It is found in Central and Southern Europe and Anatolia.

Caterpillar

The wingspan is 35–40 mm. The moth flies from April to June depending on the location.

The larvae feed on Oak.[1]

References[edit]

Further reading[edit]

  • South R. (1907) The Moths of the British Isles, (First Series), Frederick Warne & Co. Ltd., London & NY: 359 pp. online (as chaonia (Denis & Schiffermüller, 1775))
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!