Ecology

Associations

Animal / parasitoid / endoparasitoid
larva of Wagneria gagatea is endoparasitoid of larva of Drymonia ruficornis

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Drymonia ruficornis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGAATTTGAGCTGGTATAGTAGGAACTTCCCTAAGATTATTAATTCGAGCAGAATTAGGAAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACTGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTCCCTTTAATATTAGGAGCCCCTGATATAGCCTTCCCCCGAATAAATAATATAAGATTTTGATTGCTCCCACCCTCTTTAACTTTATTAATTTCAAGTAGTATCGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCCCCATTATCTTCTAATATTGCACACGGAGGAAGTTCAGTAGATTTAGCAATTTTTTCATTACATTTAGCTGGAATTTCCTCAATCTTAGGGGCTATTAATTTCATTACAACAATTATTAATATACGACTTAATGGTATATCTTTCGACCAAATACCTTTATTTGTGTGAGCCGTAGGAATTACAGCATTTTTACTTCTCCTATCTTTACCAGTATTAGCAGGAGCAATTACAATATTATTAACTGATCGAAATCTAAATACCTCATTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Drymonia ruficornis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 20
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Drymonia ruficornis

The Lunar Marbled Brown (Drymonia ruficornis) is a moth of the family Notodontidae. It is found in Central and Southern Europe and Anatolia.

Caterpillar

The wingspan is 35–40 mm. The fore wings are dark fuscous, almost blackish, with a short white line near the base; the central third is white clouded with the ground colour and limited by white edged black wavy lines. There is a black crescent just above the centre of the wing. Hind wings smoky grey with a pale curved line.Drymonia dodonaea is very similar.


The moth flies from April to June depending on the location.

The larvae feed on Oak.[1]

References[edit]

Further reading[edit]

  • South R. (1907) The Moths of the British Isles, (First Series), Frederick Warne & Co. Ltd., London & NY: 359 pp. online (as chaonia (Denis & Schiffermüller, 1775))
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!