Overview

Distribution

National Distribution

Canada

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Coleophora trifolii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 63
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Coleophora trifolii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 16 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGAGCTGAATTAGGTAATCCAGGTTCTTTAATTGGAGATGATCAAATTTATAATACAATTGTAACAGCACATGCTTTTATTATAATTTTTTTTATGGTTATGCCTATTATAATTGGAGGTTTTGGAAATTGATTAGTACCTTTAATATTAGGAGCACCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGACTTCTTCCCCCTTCATTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGTACAGGAACTGGTTGAACAGTTTACCCCCCTTTATCATCAAATATTGCTCACAGAGGTAGATCAGTAGATTTATCTATTTTTTCCCTTCATTTAGCTGGAATTTCTTCAATTTTAGGAGCAATTAATTTTATTACTACTATCATTAATATACGATTAAATAATATATCATTTGATCAACTTCCATTATTTGTTTGAGCAGTAGGAATTACAGCTCTCCTTCTTCTTCTTTCACTTCCTGTTTTAGCAGGAGCTATTACTATGTTATTAACAGATCGTAATTTAAATACTTCATTTTTTGACCCTGCTGGAGGAGGAGATCCAATTCTTTATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Coleophora trifolii

The Trefoil Thick-horned Tinea or Large Clover Case-bearer (Coleophora trifolii) is a moth of the Coleophoridae family. It is found in Europe, North Africa, Asia Minor, Afghanistan and North America.

The wingspan is 15–20 mm. Adults are on wing from June to July. They are day-active.

The larvae feed on the seeds of Melilotus species (including Melilotus officinalis and Melilotus altissima).

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!