Overview

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Coleophora pruniella

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAATAGGAACCTCTTTAAGTTTATTAATTCGAGCTGAATTAGGTAATCCAGGCTCTCTAATTGGAGATGATCAAATTTATAATGTAATTGTAACAGCTCATGCTTTCATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCCCTTATATTAGGAGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGATTTCTCCCCCCATCATTAATAATTTTAATTTCAAGAAGAATTGTAGAAAACGGTACAGGAACTGGATGAACAGTTTACCCCCCCTTATCGTCTAATATTGCCCACAGAGGAAGATCTGTTGATTTATCAATTTTTTCCCTCCACTTAGCTGGAATTTCCTCTATTTTAGGGGCAATTAATTTTATTACAACTATTATTAATATACGATTAAATAATTTATCATTTGATCAATTACCTTTATTTGTCTGAGCTGTAGGTATTACTGCTCTTCTTTTATTACTTTCTCTTCCTGTTTTAGCAGGAGCTATTACCATATTATTAACAGATCGTAATCTAAATACTTCATTTTTTGACCCGGCGGGAGGAGGAGATCCAATTCTTTATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Coleophora pruniella

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 68
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Coleophora pruniella

The Cherry Casebearer Moth (Coleophora pruniella) is a moth of the Coleophoridae family. It is found in North America, including New York, Oklahoma, Utah, Ontario and British Columbia.

The wingspan is about 11 mm.

The larvae feed on the leaves of Prunus, Rosa, Amelanchier, Betula, Alnus, Juglans, Myrica, Comptonia, Salix, Populus and Fraxinus species. They create a composite leaf case. The silken case is tubular at first. Young larvae overwinter in this case. In spring, the case is attached to a larger, irregularly oval section formed by cutting out a portion of the mine, and the early section is discarded.[2]

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!