Overview

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Coleophora bidens

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGAGCAGAATTAGGAAATCCTGGATCATTAATTGGTGATGATCAAATTTATAATACAATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTCCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGGCTTCTCCCCCCATCTTTAACTCTTTTAATTTCTAGAAGAATTGTAGAAAATGGTACTGGAACTGGTTGAACAGTTTACCCCCCTTTATCATCAAATATTGCCCATGGAGGTAGTTCAGTTGACCTATCCATTTTTTCCCTTCATTTAGCTGGTATTTCCTCTATCTTAGGGGCAATTAACTTTATTACAACTATCATTAATATACGATTAAATAATATATCATTTGATCAATTACCTTTATTTGTATGAGCTGTAGGTATTACAGCCCTTCTTCTTCTTCTCTCTCTTCCTGTTTTAGCAGGAGCTATTACCATATTATTAACAGATCGTAATTTAAATACTTCATTTTTTGATCCTGCAGGAGGGGGAGACCCAATTCTTTATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Coleophora bidens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Coleophora bidens

Coleophora bidens is a moth of the Coleophoridae family. It is found in North America, including Ohio.

The larvae feed on the seeds of Aster umbellatus. They create a trivalved, tubular silken case.

References [edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!