Overview
Distribution
National Distribution
Canada
Origin: Native
Regularity: Regularly occurring
Currently: Present
Confidence: Confident
Type of Residency: Year-round
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Coleophora bidens
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGAGCAGAATTAGGAAATCCTGGATCATTAATTGGTGATGATCAAATTTATAATACAATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTCCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGGCTTCTCCCCCCATCTTTAACTCTTTTAATTTCTAGAAGAATTGTAGAAAATGGTACTGGAACTGGTTGAACAGTTTACCCCCCTTTATCATCAAATATTGCCCATGGAGGTAGTTCAGTTGACCTATCCATTTTTTCCCTTCATTTAGCTGGTATTTCCTCTATCTTAGGGGCAATTAACTTTATTACAACTATCATTAATATACGATTAAATAATATATCATTTGATCAATTACCTTTATTTGTATGAGCTGTAGGTATTACAGCCCTTCTTCTTCTTCTCTCTCTTCCTGTTTTAGCAGGAGCTATTACCATATTATTAACAGATCGTAATTTAAATACTTCATTTTTTGATCCTGCAGGAGGGGGAGACCCAATTCTTTATCAACATTTATTT
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Coleophora bidens
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 18
Species With Barcodes: 1
Public Records: 2
Specimens with Barcodes: 18
Species With Barcodes: 1
Trusted
Conservation
Conservation Status
Wikipedia
Coleophora bidens
Coleophora bidens is a moth of the Coleophoridae family. It is found in North America, including Ohio.
The larvae feed on the seeds of Aster umbellatus. They create a trivalved, tubular silken case.
References [edit]
| Wikimedia Commons has media related to: Coleophora bidens |
| Wikispecies has information related to: Coleophora bidens |
| This article on a moth of the Coleophoridae family is a stub. You can help Wikipedia by expanding it. |
Unreviewed
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!


