Molecular Biology and Genetics
Molecular Biology
Barcode data: Coleophora acuminatoides
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
Download FASTA File
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGAGCAGAATTAGGAAATCCTGGATCATTAATTGGTGATGATCAAATTTATAATACAATTGTAACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTCCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGACTTCTCCCCCCATCTTTAACTCTTTTAATTTCTAGAAGAATTGTAGAAAATGGTACTGGAACTGGTTGAACAGTTTACCCCCCTTTATCATCAAATATTGCTCATAGAGGTAGTTCAGTTGATTTATCTATTTTTTCCCTTCATTTAGCTGGTATTTCCTCTATCTTAGGAGCAATTAACTTTATTACAACTATTATTAACATACGATTAAATAATATATCATTTGATCAATTACCTTTATTTGTATGAGCTGTAGGTATTACAGCCCTTCTTCTTCTCCTCTCTCTCCCTGTTTTAGCAGGAGCTATTACCATATTATTAACAGATCGTAATTTAAATACTTCATTTTTTGACCCTGCAGGGGGGGGAGACCCAATTCTTTATCAACATTTATT
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Coleophora acuminatoides
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Wikipedia
Coleophora acuminatoides
Coleophora acuminatoides is a moth of the Coleophoridae family. It is found in North America, including Nova Scotia.
The larvae feed on the seeds of Aster acuminatus. They create a trivalved, tubular silken case. It is similar in size to the case of Coleophora bidens, but differing in the paler coloration which in freshly formed cases is a light brown.[2]
References
 | Wikimedia Commons has media related to: Coleophora acuminatoides |
 | Wikispecies has information related to: Coleophora acuminatoides |
.jpg){kind=small} | This article on a moth of the Coleophoridae family is a stub. You can help Wikipedia by expanding it. |
Source:
Wikipedia
Unreviewed
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
