Molecular Biology and Genetics

Molecular Biology

Barcode data: Coleophora acuminatoides

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGAGCAGAATTAGGAAATCCTGGATCATTAATTGGTGATGATCAAATTTATAATACAATTGTAACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTCCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGACTTCTCCCCCCATCTTTAACTCTTTTAATTTCTAGAAGAATTGTAGAAAATGGTACTGGAACTGGTTGAACAGTTTACCCCCCTTTATCATCAAATATTGCTCATAGAGGTAGTTCAGTTGATTTATCTATTTTTTCCCTTCATTTAGCTGGTATTTCCTCTATCTTAGGAGCAATTAACTTTATTACAACTATTATTAACATACGATTAAATAATATATCATTTGATCAATTACCTTTATTTGTATGAGCTGTAGGTATTACAGCCCTTCTTCTTCTCCTCTCTCTCCCTGTTTTAGCAGGAGCTATTACCATATTATTAACAGATCGTAATTTAAATACTTCATTTTTTGACCCTGCAGGGGGGGGAGACCCAATTCTTTATCAACATTTATT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Coleophora acuminatoides

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Coleophora acuminatoides

Coleophora acuminatoides is a moth of the Coleophoridae family. It is found in North America, including Nova Scotia.

The larvae feed on the seeds of Aster acuminatus. They create a trivalved, tubular silken case. It is similar in size to the case of Coleophora bidens, but differing in the paler coloration which in freshly formed cases is a light brown.[2]

References[edit]


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!